FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625767_at:

>probe:Drosophila_2:1625767_at:374:451; Interrogation_Position=134; Antisense; GATCGATCCCAGTGTGGAGGTCAAC
>probe:Drosophila_2:1625767_at:600:335; Interrogation_Position=153; Antisense; GTCAACTTGGTGCACGGACCGTCGA
>probe:Drosophila_2:1625767_at:639:139; Interrogation_Position=166; Antisense; ACGGACCGTCGAGCAAGGTTATCAA
>probe:Drosophila_2:1625767_at:104:177; Interrogation_Position=202; Antisense; AAACGCTGCCACGACGTGTCGAGCA
>probe:Drosophila_2:1625767_at:274:421; Interrogation_Position=222; Antisense; GAGCAGCAGCTCCTTCTAATGGCCT
>probe:Drosophila_2:1625767_at:307:665; Interrogation_Position=275; Antisense; TAAATTTCGCTTGGACGAGATCCTG
>probe:Drosophila_2:1625767_at:728:87; Interrogation_Position=310; Antisense; AGTACAAGGGCGTCTACAGCATGCG
>probe:Drosophila_2:1625767_at:110:417; Interrogation_Position=354; Antisense; GAGCTGGCCATCTACACGTGGAACG
>probe:Drosophila_2:1625767_at:636:519; Interrogation_Position=371; Antisense; GTGGAACGTGATGTCCATCTCCGAT
>probe:Drosophila_2:1625767_at:617:289; Interrogation_Position=420; Antisense; CGGTTGGCGCAGCAGATTCAGCAAT
>probe:Drosophila_2:1625767_at:426:563; Interrogation_Position=448; Antisense; GGAAGCTGCGCTTTCTGGGCCACAG
>probe:Drosophila_2:1625767_at:649:257; Interrogation_Position=468; Antisense; CACAGCAGTCGGTCGGTGACCAAGA
>probe:Drosophila_2:1625767_at:692:213; Interrogation_Position=489; Antisense; AAGAGGAATCCACAATGTCCCATTG
>probe:Drosophila_2:1625767_at:310:279; Interrogation_Position=66; Antisense; CTAGTTTTTGATCTACGCTGCGAAA

Paste this into a BLAST search page for me
GATCGATCCCAGTGTGGAGGTCAACGTCAACTTGGTGCACGGACCGTCGAACGGACCGTCGAGCAAGGTTATCAAAAACGCTGCCACGACGTGTCGAGCAGAGCAGCAGCTCCTTCTAATGGCCTTAAATTTCGCTTGGACGAGATCCTGAGTACAAGGGCGTCTACAGCATGCGGAGCTGGCCATCTACACGTGGAACGGTGGAACGTGATGTCCATCTCCGATCGGTTGGCGCAGCAGATTCAGCAATGGAAGCTGCGCTTTCTGGGCCACAGCACAGCAGTCGGTCGGTGACCAAGAAAGAGGAATCCACAATGTCCCATTGCTAGTTTTTGATCTACGCTGCGAAA

Full Affymetrix probeset data:

Annotations for 1625767_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720