Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625769_at:

>probe:Drosophila_2:1625769_at:354:483; Interrogation_Position=1120; Antisense; GTATCTCGTCCTAATCTAGCGGCAA
>probe:Drosophila_2:1625769_at:539:193; Interrogation_Position=1192; Antisense; AACTGCACTTATCATGATCCTCGTC
>probe:Drosophila_2:1625769_at:640:47; Interrogation_Position=1208; Antisense; ATCCTCGTCCGCAATTCGATTGGGA
>probe:Drosophila_2:1625769_at:111:177; Interrogation_Position=1241; Antisense; AAACGCCGGCTTGGAAATCACTGTC
>probe:Drosophila_2:1625769_at:284:239; Interrogation_Position=1256; Antisense; AATCACTGTCCTTGAACGAATCCCA
>probe:Drosophila_2:1625769_at:651:225; Interrogation_Position=1282; Antisense; AAGGCACTGCTATCCATTCGGTTGG
>probe:Drosophila_2:1625769_at:157:133; Interrogation_Position=1309; Antisense; ACTCGCAAGGCAGAGCAGGCTTTTC
>probe:Drosophila_2:1625769_at:470:569; Interrogation_Position=1326; Antisense; GGCTTTTCAGGAGCGTCAGTACGAA
>probe:Drosophila_2:1625769_at:395:303; Interrogation_Position=1457; Antisense; CCGAGGAACTGCGTCATTCGTGCGA
>probe:Drosophila_2:1625769_at:677:99; Interrogation_Position=1512; Antisense; AGAGTTTCCTGTTCCCGATGCGGAT
>probe:Drosophila_2:1625769_at:449:359; Interrogation_Position=1548; Antisense; GCAACTGCGTAAGGTCTATGGCTCA
>probe:Drosophila_2:1625769_at:596:169; Interrogation_Position=1575; Antisense; AAAGTCCTGTTCGAGGCAGTCTCAA
>probe:Drosophila_2:1625769_at:154:85; Interrogation_Position=1592; Antisense; AGTCTCAACGAAGCAAGCGGTCCGA
>probe:Drosophila_2:1625769_at:493:611; Interrogation_Position=1665; Antisense; TGACGACCTGTGCAGCGCAGATCGA

Paste this into a BLAST search page for me
GTATCTCGTCCTAATCTAGCGGCAAAACTGCACTTATCATGATCCTCGTCATCCTCGTCCGCAATTCGATTGGGAAAACGCCGGCTTGGAAATCACTGTCAATCACTGTCCTTGAACGAATCCCAAAGGCACTGCTATCCATTCGGTTGGACTCGCAAGGCAGAGCAGGCTTTTCGGCTTTTCAGGAGCGTCAGTACGAACCGAGGAACTGCGTCATTCGTGCGAAGAGTTTCCTGTTCCCGATGCGGATGCAACTGCGTAAGGTCTATGGCTCAAAAGTCCTGTTCGAGGCAGTCTCAAAGTCTCAACGAAGCAAGCGGTCCGATGACGACCTGTGCAGCGCAGATCGA

Full Affymetrix probeset data:

Annotations for 1625769_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime