FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625770_at:

>probe:Drosophila_2:1625770_at:225:207; Interrogation_Position=2099; Antisense; AAGCTACGGAGCTGCGGTAATCGAT
>probe:Drosophila_2:1625770_at:355:111; Interrogation_Position=2130; Antisense; AGAATTATCCTTGCGGACATCGCTG
>probe:Drosophila_2:1625770_at:16:73; Interrogation_Position=2173; Antisense; AGGCAAGTGCCCAAATCCCGAGTTG
>probe:Drosophila_2:1625770_at:563:165; Interrogation_Position=2185; Antisense; AAATCCCGAGTTGTGCCGCAAGAAG
>probe:Drosophila_2:1625770_at:78:211; Interrogation_Position=2204; Antisense; AAGAAGGTTCGCATTTTCTGCGCCT
>probe:Drosophila_2:1625770_at:723:463; Interrogation_Position=2248; Antisense; GATTGCCTGTGACAAACACCGTGCT
>probe:Drosophila_2:1625770_at:78:157; Interrogation_Position=2263; Antisense; ACACCGTGCTGGTCAGACATTCTTG
>probe:Drosophila_2:1625770_at:87:113; Interrogation_Position=2313; Antisense; AGCAAATTCGCGTCCAGGCGGCAGA
>probe:Drosophila_2:1625770_at:593:391; Interrogation_Position=2379; Antisense; GAAACCGCCTGGAACTCGAGAAGTT
>probe:Drosophila_2:1625770_at:535:577; Interrogation_Position=2407; Antisense; GGCCAAGTTCGGCAAACGCAAGCAC
>probe:Drosophila_2:1625770_at:525:193; Interrogation_Position=2443; Antisense; AACTGTGGGTTCTGGACCGGCCAAG
>probe:Drosophila_2:1625770_at:355:617; Interrogation_Position=2500; Antisense; TGCAGTATCCATTCTAACAGTTGTG
>probe:Drosophila_2:1625770_at:689:529; Interrogation_Position=2524; Antisense; GGGTGCAATTGTGGTGGCTTTCTAC
>probe:Drosophila_2:1625770_at:245:533; Interrogation_Position=2536; Antisense; GGTGGCTTTCTACGCGGACAGTTAA

Paste this into a BLAST search page for me
AAGCTACGGAGCTGCGGTAATCGATAGAATTATCCTTGCGGACATCGCTGAGGCAAGTGCCCAAATCCCGAGTTGAAATCCCGAGTTGTGCCGCAAGAAGAAGAAGGTTCGCATTTTCTGCGCCTGATTGCCTGTGACAAACACCGTGCTACACCGTGCTGGTCAGACATTCTTGAGCAAATTCGCGTCCAGGCGGCAGAGAAACCGCCTGGAACTCGAGAAGTTGGCCAAGTTCGGCAAACGCAAGCACAACTGTGGGTTCTGGACCGGCCAAGTGCAGTATCCATTCTAACAGTTGTGGGGTGCAATTGTGGTGGCTTTCTACGGTGGCTTTCTACGCGGACAGTTAA

Full Affymetrix probeset data:

Annotations for 1625770_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720