FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625771_at:

>probe:Drosophila_2:1625771_at:446:143; Interrogation_Position=1576; Antisense; ACTAGTGACGTGAGTTTCGAGCCCG
>probe:Drosophila_2:1625771_at:481:691; Interrogation_Position=1590; Antisense; TTTCGAGCCCGATATACCGTACCCA
>probe:Drosophila_2:1625771_at:119:415; Interrogation_Position=1594; Antisense; GAGCCCGATATACCGTACCCAGTTG
>probe:Drosophila_2:1625771_at:195:293; Interrogation_Position=1599; Antisense; CGATATACCGTACCCAGTTGGCTGT
>probe:Drosophila_2:1625771_at:22:23; Interrogation_Position=1601; Antisense; ATATACCGTACCCAGTTGGCTGTAA
>probe:Drosophila_2:1625771_at:114:673; Interrogation_Position=1604; Antisense; TACCGTACCCAGTTGGCTGTAAACG
>probe:Drosophila_2:1625771_at:389:133; Interrogation_Position=1610; Antisense; ACCCAGTTGGCTGTAAACGATGAAT
>probe:Drosophila_2:1625771_at:317:197; Interrogation_Position=1625; Antisense; AACGATGAATCAGCCCGTTTACCAC
>probe:Drosophila_2:1625771_at:6:615; Interrogation_Position=1630; Antisense; TGAATCAGCCCGTTTACCACCAGCT
>probe:Drosophila_2:1625771_at:95:665; Interrogation_Position=1671; Antisense; TTTCGAAGTCTCCTAACCCCGCTAT
>probe:Drosophila_2:1625771_at:99:297; Interrogation_Position=1674; Antisense; CGAAGTCTCCTAACCCCGCTATGGG
>probe:Drosophila_2:1625771_at:166:719; Interrogation_Position=1700; Antisense; TTCCCTTGATCCGTTTAACACACAG
>probe:Drosophila_2:1625771_at:80:275; Interrogation_Position=1704; Antisense; CTTGATCCGTTTAACACACAGTGTT
>probe:Drosophila_2:1625771_at:636:661; Interrogation_Position=1715; Antisense; TAACACACAGTGTTTGGCCGGCGGT

Paste this into a BLAST search page for me
ACTAGTGACGTGAGTTTCGAGCCCGTTTCGAGCCCGATATACCGTACCCAGAGCCCGATATACCGTACCCAGTTGCGATATACCGTACCCAGTTGGCTGTATATACCGTACCCAGTTGGCTGTAATACCGTACCCAGTTGGCTGTAAACGACCCAGTTGGCTGTAAACGATGAATAACGATGAATCAGCCCGTTTACCACTGAATCAGCCCGTTTACCACCAGCTTTTCGAAGTCTCCTAACCCCGCTATCGAAGTCTCCTAACCCCGCTATGGGTTCCCTTGATCCGTTTAACACACAGCTTGATCCGTTTAACACACAGTGTTTAACACACAGTGTTTGGCCGGCGGT

Full Affymetrix probeset data:

Annotations for 1625771_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720