FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625773_at:

>probe:Drosophila_2:1625773_at:689:195; Interrogation_Position=1034; Antisense; AACGGATCTGAGAAATGAGTTCGCA
>probe:Drosophila_2:1625773_at:653:57; Interrogation_Position=1048; Antisense; ATGAGTTCGCAGATCTAGGTCGCAT
>probe:Drosophila_2:1625773_at:15:95; Interrogation_Position=1051; Antisense; AGTTCGCAGATCTAGGTCGCATGCT
>probe:Drosophila_2:1625773_at:573:295; Interrogation_Position=1055; Antisense; CGCAGATCTAGGTCGCATGCTGATT
>probe:Drosophila_2:1625773_at:710:451; Interrogation_Position=1059; Antisense; GATCTAGGTCGCATGCTGATTCCTA
>probe:Drosophila_2:1625773_at:414:79; Interrogation_Position=1064; Antisense; AGGTCGCATGCTGATTCCTACCGGG
>probe:Drosophila_2:1625773_at:91:399; Interrogation_Position=1089; Antisense; GACAGAGGTGCGTACCTCTCCCTCT
>probe:Drosophila_2:1625773_at:715:129; Interrogation_Position=1225; Antisense; ACCTTGTCCTACAAAGAACACACAA
>probe:Drosophila_2:1625773_at:514:231; Interrogation_Position=842; Antisense; AATGATCGTCATACTGCCGAAGCCT
>probe:Drosophila_2:1625773_at:665:625; Interrogation_Position=856; Antisense; TGCCGAAGCCTTCCCAGAGAGTAAG
>probe:Drosophila_2:1625773_at:717:375; Interrogation_Position=860; Antisense; GAAGCCTTCCCAGAGAGTAAGCCTG
>probe:Drosophila_2:1625773_at:393:265; Interrogation_Position=870; Antisense; CAGAGAGTAAGCCTGGTGCTCAAAC
>probe:Drosophila_2:1625773_at:258:431; Interrogation_Position=874; Antisense; GAGTAAGCCTGGTGCTCAAACAATT
>probe:Drosophila_2:1625773_at:73:127; Interrogation_Position=879; Antisense; AGCCTGGTGCTCAAACAATTGAAGA

Paste this into a BLAST search page for me
AACGGATCTGAGAAATGAGTTCGCAATGAGTTCGCAGATCTAGGTCGCATAGTTCGCAGATCTAGGTCGCATGCTCGCAGATCTAGGTCGCATGCTGATTGATCTAGGTCGCATGCTGATTCCTAAGGTCGCATGCTGATTCCTACCGGGGACAGAGGTGCGTACCTCTCCCTCTACCTTGTCCTACAAAGAACACACAAAATGATCGTCATACTGCCGAAGCCTTGCCGAAGCCTTCCCAGAGAGTAAGGAAGCCTTCCCAGAGAGTAAGCCTGCAGAGAGTAAGCCTGGTGCTCAAACGAGTAAGCCTGGTGCTCAAACAATTAGCCTGGTGCTCAAACAATTGAAGA

Full Affymetrix probeset data:

Annotations for 1625773_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720