FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625774_at:

>probe:Drosophila_2:1625774_at:54:239; Interrogation_Position=115; Antisense; AATCGGCCAGTAGATTGCGGCGAAA
>probe:Drosophila_2:1625774_at:526:327; Interrogation_Position=131; Antisense; GCGGCGAAAACTGTCAATGTACTCA
>probe:Drosophila_2:1625774_at:58:271; Interrogation_Position=229; Antisense; CATCCATTTCATTTGCACGGTACCT
>probe:Drosophila_2:1625774_at:493:355; Interrogation_Position=243; Antisense; GCACGGTACCTCCTTTTATGTACTA
>probe:Drosophila_2:1625774_at:381:679; Interrogation_Position=259; Antisense; TATGTACTAGGACTTGGGCGCTCCC
>probe:Drosophila_2:1625774_at:646:321; Interrogation_Position=276; Antisense; GCGCTCCCCGGATAAGCAAATTCAA
>probe:Drosophila_2:1625774_at:247:53; Interrogation_Position=304; Antisense; ATGAACTTAAAGCATGCCCTGGAGC
>probe:Drosophila_2:1625774_at:167:587; Interrogation_Position=323; Antisense; TGGAGCTTGACCAACGCGGATTGTT
>probe:Drosophila_2:1625774_at:48:373; Interrogation_Position=375; Antisense; GAAGGATACTGTTGCGGTACCAAAC
>probe:Drosophila_2:1625774_at:688:671; Interrogation_Position=415; Antisense; TTACGATTTCGTGCAGATAACCCTG
>probe:Drosophila_2:1625774_at:270:241; Interrogation_Position=504; Antisense; AATAGGTACTCCCAATGACTTGCCT
>probe:Drosophila_2:1625774_at:207:653; Interrogation_Position=540; Antisense; TAATTTCCCTCGTTGTGGCAACCAT
>probe:Drosophila_2:1625774_at:263:583; Interrogation_Position=555; Antisense; TGGCAACCATTTACCACCCATAAAG
>probe:Drosophila_2:1625774_at:549:275; Interrogation_Position=56; Antisense; CTTCCCCGATGCTATCACAGTATAA

Paste this into a BLAST search page for me
AATCGGCCAGTAGATTGCGGCGAAAGCGGCGAAAACTGTCAATGTACTCACATCCATTTCATTTGCACGGTACCTGCACGGTACCTCCTTTTATGTACTATATGTACTAGGACTTGGGCGCTCCCGCGCTCCCCGGATAAGCAAATTCAAATGAACTTAAAGCATGCCCTGGAGCTGGAGCTTGACCAACGCGGATTGTTGAAGGATACTGTTGCGGTACCAAACTTACGATTTCGTGCAGATAACCCTGAATAGGTACTCCCAATGACTTGCCTTAATTTCCCTCGTTGTGGCAACCATTGGCAACCATTTACCACCCATAAAGCTTCCCCGATGCTATCACAGTATAA

Full Affymetrix probeset data:

Annotations for 1625774_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720