FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625776_at:

>probe:Drosophila_2:1625776_at:33:73; Interrogation_Position=243; Antisense; AGGCAAATCCGACTAGTTTCATCCC
>probe:Drosophila_2:1625776_at:447:127; Interrogation_Position=338; Antisense; AGCCACGTCCCGGATGACTGGAAGA
>probe:Drosophila_2:1625776_at:369:405; Interrogation_Position=353; Antisense; GACTGGAAGATTCGCCTACTCGACG
>probe:Drosophila_2:1625776_at:440:375; Interrogation_Position=407; Antisense; GAAGATCGACGAAGTCCTGTGCCAC
>probe:Drosophila_2:1625776_at:581:379; Interrogation_Position=441; Antisense; GAACCCAATCCAGAGTACCATCATG
>probe:Drosophila_2:1625776_at:379:53; Interrogation_Position=463; Antisense; ATGCTCCGCGATGCTTTGTTAAGAA
>probe:Drosophila_2:1625776_at:621:261; Interrogation_Position=568; Antisense; CAGACTTCCGGCGACGAATGGTTTA
>probe:Drosophila_2:1625776_at:555:65; Interrogation_Position=585; Antisense; ATGGTTTATGGCACCTACGATATCT
>probe:Drosophila_2:1625776_at:99:677; Interrogation_Position=609; Antisense; TAGACGGTTTCTCTTGAAGCTCTCT
>probe:Drosophila_2:1625776_at:431:643; Interrogation_Position=629; Antisense; TCTCTGCAATCAATTTCCATCCGGA
>probe:Drosophila_2:1625776_at:153:719; Interrogation_Position=643; Antisense; TTCCATCCGGACATGTCTTGTACGA
>probe:Drosophila_2:1625776_at:524:25; Interrogation_Position=693; Antisense; ATAACGAAGTATCCCAAACCCACAT
>probe:Drosophila_2:1625776_at:445:421; Interrogation_Position=751; Antisense; GATAAACGGATCCAACTCGGTCGTC
>probe:Drosophila_2:1625776_at:223:537; Interrogation_Position=769; Antisense; GGTCGTCCGCTCAAATTGCAATATA

Paste this into a BLAST search page for me
AGGCAAATCCGACTAGTTTCATCCCAGCCACGTCCCGGATGACTGGAAGAGACTGGAAGATTCGCCTACTCGACGGAAGATCGACGAAGTCCTGTGCCACGAACCCAATCCAGAGTACCATCATGATGCTCCGCGATGCTTTGTTAAGAACAGACTTCCGGCGACGAATGGTTTAATGGTTTATGGCACCTACGATATCTTAGACGGTTTCTCTTGAAGCTCTCTTCTCTGCAATCAATTTCCATCCGGATTCCATCCGGACATGTCTTGTACGAATAACGAAGTATCCCAAACCCACATGATAAACGGATCCAACTCGGTCGTCGGTCGTCCGCTCAAATTGCAATATA

Full Affymetrix probeset data:

Annotations for 1625776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720