Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625777_at:

>probe:Drosophila_2:1625777_at:592:51; Interrogation_Position=1166; Antisense; ATGCGATACAAAGGGCTCAGCGTCT
>probe:Drosophila_2:1625777_at:63:573; Interrogation_Position=1179; Antisense; GGCTCAGCGTCTAATGGAATCCTCA
>probe:Drosophila_2:1625777_at:570:549; Interrogation_Position=1194; Antisense; GGAATCCTCAAAGCGTTGGCCCAGA
>probe:Drosophila_2:1625777_at:605:513; Interrogation_Position=1220; Antisense; GTGTTAATACATACATGCCGCCGTC
>probe:Drosophila_2:1625777_at:516:485; Interrogation_Position=1306; Antisense; GTAGAGCCATCAGCGCCAGAAATGT
>probe:Drosophila_2:1625777_at:179:107; Interrogation_Position=1323; Antisense; AGAAATGTCCGAAGGTCTACCGCAG
>probe:Drosophila_2:1625777_at:429:547; Interrogation_Position=1356; Antisense; GGATGATTGTTTCATTGCTCGCCTC
>probe:Drosophila_2:1625777_at:507:695; Interrogation_Position=1381; Antisense; TTTCGTGGCACACTATTGCGACTGA
>probe:Drosophila_2:1625777_at:503:477; Interrogation_Position=1485; Antisense; GTTTATACCCAACGCTATGTCGAGA
>probe:Drosophila_2:1625777_at:523:211; Interrogation_Position=1559; Antisense; AAGATCTCTTTCTCCAAACCGATTT
>probe:Drosophila_2:1625777_at:728:17; Interrogation_Position=1580; Antisense; ATTTCTATTCGAGCAACCTGGACGC
>probe:Drosophila_2:1625777_at:311:465; Interrogation_Position=1647; Antisense; GTTGGTCCAGCCGAAAGTTGTAGTT
>probe:Drosophila_2:1625777_at:120:517; Interrogation_Position=1697; Antisense; GTGTGCGTCCCATGGAGAGCTATGT
>probe:Drosophila_2:1625777_at:434:419; Interrogation_Position=1713; Antisense; GAGCTATGTGCTCGAAACCGACCAA

Paste this into a BLAST search page for me
ATGCGATACAAAGGGCTCAGCGTCTGGCTCAGCGTCTAATGGAATCCTCAGGAATCCTCAAAGCGTTGGCCCAGAGTGTTAATACATACATGCCGCCGTCGTAGAGCCATCAGCGCCAGAAATGTAGAAATGTCCGAAGGTCTACCGCAGGGATGATTGTTTCATTGCTCGCCTCTTTCGTGGCACACTATTGCGACTGAGTTTATACCCAACGCTATGTCGAGAAAGATCTCTTTCTCCAAACCGATTTATTTCTATTCGAGCAACCTGGACGCGTTGGTCCAGCCGAAAGTTGTAGTTGTGTGCGTCCCATGGAGAGCTATGTGAGCTATGTGCTCGAAACCGACCAA

Full Affymetrix probeset data:

Annotations for 1625777_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime