Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625778_at:

>probe:Drosophila_2:1625778_at:685:713; Interrogation_Position=3642; Antisense; TTCTCGGGCACCATGCGTTACAATC
>probe:Drosophila_2:1625778_at:458:675; Interrogation_Position=3686; Antisense; TAGCGACGCCAAGCTGTGGGAGTCT
>probe:Drosophila_2:1625778_at:448:111; Interrogation_Position=3730; Antisense; AGCAAGTGGTGGCTGATCTTCCCAG
>probe:Drosophila_2:1625778_at:361:227; Interrogation_Position=3778; Antisense; AAGGCGGCACCAACTTCAGCGTGGG
>probe:Drosophila_2:1625778_at:381:675; Interrogation_Position=3823; Antisense; TAGCTAGGGCCATTCTCCGAGAGAA
>probe:Drosophila_2:1625778_at:561:39; Interrogation_Position=3865; Antisense; ACGAGGCAACGGCTAACGTCGATCC
>probe:Drosophila_2:1625778_at:561:445; Interrogation_Position=3897; Antisense; GATGCTCTTATCCAGACGACGATTA
>probe:Drosophila_2:1625778_at:624:625; Interrogation_Position=3956; Antisense; TGCCCATCGATTGCATACGGTTATG
>probe:Drosophila_2:1625778_at:376:109; Interrogation_Position=4063; Antisense; AGAAGGTCTTCCACAGCATGGTGAA
>probe:Drosophila_2:1625778_at:361:105; Interrogation_Position=4090; Antisense; AGACGGGAGACTCCACTTTCGATGC
>probe:Drosophila_2:1625778_at:153:51; Interrogation_Position=4111; Antisense; ATGCCCTGCTGAAGGTTGCCCAAAA
>probe:Drosophila_2:1625778_at:548:599; Interrogation_Position=4161; Antisense; TGTAACTTGTCCACATGCCTAAGCT
>probe:Drosophila_2:1625778_at:473:659; Interrogation_Position=4180; Antisense; TAAGCTCTTTGTCTTCCTTTCAGGC
>probe:Drosophila_2:1625778_at:60:397; Interrogation_Position=4212; Antisense; GACAACCTGCGGCTCAAGAAGGATT

Paste this into a BLAST search page for me
TTCTCGGGCACCATGCGTTACAATCTAGCGACGCCAAGCTGTGGGAGTCTAGCAAGTGGTGGCTGATCTTCCCAGAAGGCGGCACCAACTTCAGCGTGGGTAGCTAGGGCCATTCTCCGAGAGAAACGAGGCAACGGCTAACGTCGATCCGATGCTCTTATCCAGACGACGATTATGCCCATCGATTGCATACGGTTATGAGAAGGTCTTCCACAGCATGGTGAAAGACGGGAGACTCCACTTTCGATGCATGCCCTGCTGAAGGTTGCCCAAAATGTAACTTGTCCACATGCCTAAGCTTAAGCTCTTTGTCTTCCTTTCAGGCGACAACCTGCGGCTCAAGAAGGATT

Full Affymetrix probeset data:

Annotations for 1625778_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime