Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625779_at:

>probe:Drosophila_2:1625779_at:164:75; Interrogation_Position=3291; Antisense; AGGACTTTCGCATCGAGACGCTGAT
>probe:Drosophila_2:1625779_at:325:425; Interrogation_Position=3350; Antisense; GAGACCAGCGACTAGGCGGGATTCC
>probe:Drosophila_2:1625779_at:250:259; Interrogation_Position=3375; Antisense; CACTCGCTTGAACCAATTGGCTTGT
>probe:Drosophila_2:1625779_at:619:569; Interrogation_Position=3393; Antisense; GGCTTGTGTACAGTCCATTGAACGG
>probe:Drosophila_2:1625779_at:149:383; Interrogation_Position=3412; Antisense; GAACGGTGATTTCAGTTTCGATCTA
>probe:Drosophila_2:1625779_at:669:643; Interrogation_Position=3433; Antisense; TCTAAGCACGTTTTAACAGCCCACT
>probe:Drosophila_2:1625779_at:600:485; Interrogation_Position=3531; Antisense; GTAGGAGCCAGCACACGAGTTTTTA
>probe:Drosophila_2:1625779_at:134:201; Interrogation_Position=3576; Antisense; AACGCTATAGTTGCCAGTCCACTTA
>probe:Drosophila_2:1625779_at:194:627; Interrogation_Position=3587; Antisense; TGCCAGTCCACTTACGTACTAAACA
>probe:Drosophila_2:1625779_at:479:489; Interrogation_Position=3634; Antisense; GTAAATCTGAAGCATCGCACGTCTA
>probe:Drosophila_2:1625779_at:288:347; Interrogation_Position=3645; Antisense; GCATCGCACGTCTATAGTATACTTT
>probe:Drosophila_2:1625779_at:541:583; Interrogation_Position=3690; Antisense; TGGAGTCGGGATTTCAGGTTCTAGA
>probe:Drosophila_2:1625779_at:469:541; Interrogation_Position=3706; Antisense; GGTTCTAGACCTATATCTACCATGC
>probe:Drosophila_2:1625779_at:628:597; Interrogation_Position=3759; Antisense; TGTGCGTCTGCGTGTAACTGTAACA

Paste this into a BLAST search page for me
AGGACTTTCGCATCGAGACGCTGATGAGACCAGCGACTAGGCGGGATTCCCACTCGCTTGAACCAATTGGCTTGTGGCTTGTGTACAGTCCATTGAACGGGAACGGTGATTTCAGTTTCGATCTATCTAAGCACGTTTTAACAGCCCACTGTAGGAGCCAGCACACGAGTTTTTAAACGCTATAGTTGCCAGTCCACTTATGCCAGTCCACTTACGTACTAAACAGTAAATCTGAAGCATCGCACGTCTAGCATCGCACGTCTATAGTATACTTTTGGAGTCGGGATTTCAGGTTCTAGAGGTTCTAGACCTATATCTACCATGCTGTGCGTCTGCGTGTAACTGTAACA

Full Affymetrix probeset data:

Annotations for 1625779_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime