Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625780_a_at:

>probe:Drosophila_2:1625780_a_at:158:241; Interrogation_Position=1027; Antisense; AATAAAGCATCTGCACACTGGACAG
>probe:Drosophila_2:1625780_a_at:584:603; Interrogation_Position=1086; Antisense; TGATTTGCCATTAGTCATTACCCAA
>probe:Drosophila_2:1625780_a_at:194:707; Interrogation_Position=1103; Antisense; TTACCCAAAATCAAGCTACGAGCTG
>probe:Drosophila_2:1625780_a_at:330:163; Interrogation_Position=1239; Antisense; AAATTCACTTACATTGCTAGTCTAC
>probe:Drosophila_2:1625780_a_at:192:339; Interrogation_Position=1254; Antisense; GCTAGTCTACACATAACTTGTTTGA
>probe:Drosophila_2:1625780_a_at:539:517; Interrogation_Position=749; Antisense; GTGGTCCAGGCCCACAAGTACAAGT
>probe:Drosophila_2:1625780_a_at:84:161; Interrogation_Position=762; Antisense; ACAAGTACAAGTCCGTCCAGCGACC
>probe:Drosophila_2:1625780_a_at:163:413; Interrogation_Position=783; Antisense; GACCCCAGGCCGTGAACAATCGCTT
>probe:Drosophila_2:1625780_a_at:534:623; Interrogation_Position=846; Antisense; TCGATATTCCCATTGGCATCCTGCG
>probe:Drosophila_2:1625780_a_at:302:617; Interrogation_Position=876; Antisense; TGCAGCAATCCTTGGGCGCCCTGGG
>probe:Drosophila_2:1625780_a_at:12:95; Interrogation_Position=934; Antisense; AGTTGCAGGTGCTCAGGCCAATGCG
>probe:Drosophila_2:1625780_a_at:528:311; Interrogation_Position=950; Antisense; GCCAATGCGCACAACCACTAGAGAT
>probe:Drosophila_2:1625780_a_at:675:17; Interrogation_Position=978; Antisense; ATTTCGAGATTCGTACGACCTCTGA
>probe:Drosophila_2:1625780_a_at:149:487; Interrogation_Position=990; Antisense; GTACGACCTCTGAAGCATCAAAGAT

Paste this into a BLAST search page for me
AATAAAGCATCTGCACACTGGACAGTGATTTGCCATTAGTCATTACCCAATTACCCAAAATCAAGCTACGAGCTGAAATTCACTTACATTGCTAGTCTACGCTAGTCTACACATAACTTGTTTGAGTGGTCCAGGCCCACAAGTACAAGTACAAGTACAAGTCCGTCCAGCGACCGACCCCAGGCCGTGAACAATCGCTTTCGATATTCCCATTGGCATCCTGCGTGCAGCAATCCTTGGGCGCCCTGGGAGTTGCAGGTGCTCAGGCCAATGCGGCCAATGCGCACAACCACTAGAGATATTTCGAGATTCGTACGACCTCTGAGTACGACCTCTGAAGCATCAAAGAT

Full Affymetrix probeset data:

Annotations for 1625780_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime