FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625781_at:

>probe:Drosophila_2:1625781_at:588:687; Interrogation_Position=1356; Antisense; TATAGACGGCCAGTACAGCACAGGA
>probe:Drosophila_2:1625781_at:210:201; Interrogation_Position=1430; Antisense; AACCGCGTAGACTTAAGGACAGCCT
>probe:Drosophila_2:1625781_at:448:125; Interrogation_Position=1450; Antisense; AGCCTCTTTGCACGCGCACAAGGAG
>probe:Drosophila_2:1625781_at:473:567; Interrogation_Position=1508; Antisense; GGCATTGTTAAGCATACCCATACCC
>probe:Drosophila_2:1625781_at:106:645; Interrogation_Position=1543; Antisense; TCACGTCTCCGTCGTAGCTTTTAGA
>probe:Drosophila_2:1625781_at:531:347; Interrogation_Position=1676; Antisense; GCATCCGCCTGCATATGATAGCACA
>probe:Drosophila_2:1625781_at:591:355; Interrogation_Position=1705; Antisense; GCACATACATGCATACAGGACCTGA
>probe:Drosophila_2:1625781_at:716:95; Interrogation_Position=1737; Antisense; ACGCTTTTGTCCAGACCCGAATCGG
>probe:Drosophila_2:1625781_at:460:41; Interrogation_Position=1757; Antisense; ATCGGACTCCAACTTGACCACAAAT
>probe:Drosophila_2:1625781_at:8:415; Interrogation_Position=1772; Antisense; GACCACAAATTGAACAGCGCCGCAT
>probe:Drosophila_2:1625781_at:509:155; Interrogation_Position=1785; Antisense; ACAGCGCCGCATTCGGAATTTTGAC
>probe:Drosophila_2:1625781_at:253:79; Interrogation_Position=1798; Antisense; CGGAATTTTGACTCGTGTGCTAGTA
>probe:Drosophila_2:1625781_at:35:601; Interrogation_Position=1828; Antisense; TGTAAAACATCTCTCACACCTTGAG
>probe:Drosophila_2:1625781_at:357:151; Interrogation_Position=1843; Antisense; ACACCTTGAGAAGCCCACTTATGTG

Paste this into a BLAST search page for me
TATAGACGGCCAGTACAGCACAGGAAACCGCGTAGACTTAAGGACAGCCTAGCCTCTTTGCACGCGCACAAGGAGGGCATTGTTAAGCATACCCATACCCTCACGTCTCCGTCGTAGCTTTTAGAGCATCCGCCTGCATATGATAGCACAGCACATACATGCATACAGGACCTGAACGCTTTTGTCCAGACCCGAATCGGATCGGACTCCAACTTGACCACAAATGACCACAAATTGAACAGCGCCGCATACAGCGCCGCATTCGGAATTTTGACCGGAATTTTGACTCGTGTGCTAGTATGTAAAACATCTCTCACACCTTGAGACACCTTGAGAAGCCCACTTATGTG

Full Affymetrix probeset data:

Annotations for 1625781_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720