Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625782_at:

>probe:Drosophila_2:1625782_at:328:533; Interrogation_Position=1087; Antisense; GGTGGCAAATACTCCGCGAATGTCA
>probe:Drosophila_2:1625782_at:711:163; Interrogation_Position=1115; Antisense; AAATCGGCGGCTATCGCAATTCGAT
>probe:Drosophila_2:1625782_at:499:51; Interrogation_Position=1138; Antisense; ATGCGGCTTCATATAAATCCCCTCA
>probe:Drosophila_2:1625782_at:495:447; Interrogation_Position=1178; Antisense; GATCCTATCGTTGCGTGGCCAAGAA
>probe:Drosophila_2:1625782_at:303:523; Interrogation_Position=1192; Antisense; GTGGCCAAGAATTCCCTGGGCGACA
>probe:Drosophila_2:1625782_at:398:593; Interrogation_Position=1208; Antisense; TGGGCGACACGGACGGCACAATTAA
>probe:Drosophila_2:1625782_at:360:369; Interrogation_Position=1251; Antisense; GAATGCCGTCAACTATGTGGAGAAC
>probe:Drosophila_2:1625782_at:677:551; Interrogation_Position=1269; Antisense; GGAGAACTTTGAGGCGCGGCACAAA
>probe:Drosophila_2:1625782_at:704:387; Interrogation_Position=1308; Antisense; GAAAAGCTCGGAGTCGCATCATCCG
>probe:Drosophila_2:1625782_at:293:721; Interrogation_Position=1415; Antisense; TTGACAGCATTTACGGAAACTCCGC
>probe:Drosophila_2:1625782_at:102:89; Interrogation_Position=1494; Antisense; AGTCGCTGTGGCAGTGGCTATGTCA
>probe:Drosophila_2:1625782_at:289:561; Interrogation_Position=1542; Antisense; GGAAACTCAGATGACACTGCCGCCA
>probe:Drosophila_2:1625782_at:251:179; Interrogation_Position=1568; Antisense; AAACACTGACGCATCCGGAGGTGGA
>probe:Drosophila_2:1625782_at:124:431; Interrogation_Position=1639; Antisense; GAGTCACGGTCTGTGGCAGTGCAAT

Paste this into a BLAST search page for me
GGTGGCAAATACTCCGCGAATGTCAAAATCGGCGGCTATCGCAATTCGATATGCGGCTTCATATAAATCCCCTCAGATCCTATCGTTGCGTGGCCAAGAAGTGGCCAAGAATTCCCTGGGCGACATGGGCGACACGGACGGCACAATTAAGAATGCCGTCAACTATGTGGAGAACGGAGAACTTTGAGGCGCGGCACAAAGAAAAGCTCGGAGTCGCATCATCCGTTGACAGCATTTACGGAAACTCCGCAGTCGCTGTGGCAGTGGCTATGTCAGGAAACTCAGATGACACTGCCGCCAAAACACTGACGCATCCGGAGGTGGAGAGTCACGGTCTGTGGCAGTGCAAT

Full Affymetrix probeset data:

Annotations for 1625782_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime