FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625783_at:

>probe:Drosophila_2:1625783_at:126:675; Interrogation_Position=283; Antisense; TAGAAGCCTTCATTCTAGCCGAACT
>probe:Drosophila_2:1625783_at:699:435; Interrogation_Position=312; Antisense; GAGGATTCAGGCTTCGAGTCCGGCA
>probe:Drosophila_2:1625783_at:246:27; Interrogation_Position=384; Antisense; ATAGCACCCATGTATGAGCCATCAT
>probe:Drosophila_2:1625783_at:261:655; Interrogation_Position=427; Antisense; TAATGTTGCACCAACCTTGGGCTAC
>probe:Drosophila_2:1625783_at:52:59; Interrogation_Position=459; Antisense; ATGTATGCCGGTGGACCAATTCGCC
>probe:Drosophila_2:1625783_at:659:309; Interrogation_Position=474; Antisense; CCAATTCGCCCGCATTATGGACAAT
>probe:Drosophila_2:1625783_at:255:355; Interrogation_Position=502; Antisense; GCACGGCATTAATTAACTCGCAGTC
>probe:Drosophila_2:1625783_at:492:193; Interrogation_Position=516; Antisense; AACTCGCAGTCTTACCTTTTGCAAA
>probe:Drosophila_2:1625783_at:448:415; Interrogation_Position=568; Antisense; GAGCCATGTTTCGAAATGCCTTAGT
>probe:Drosophila_2:1625783_at:235:465; Interrogation_Position=591; Antisense; GTTGGGTTTCGGTTTATTCATGTCG
>probe:Drosophila_2:1625783_at:571:271; Interrogation_Position=673; Antisense; CATCTGTATCTGTGTGCGAGTTGCA
>probe:Drosophila_2:1625783_at:307:713; Interrogation_Position=798; Antisense; TTCTTCGAATTTACCATACGCTCTC
>probe:Drosophila_2:1625783_at:691:27; Interrogation_Position=813; Antisense; ATACGCTCTCTTGTGCAACATCAAT
>probe:Drosophila_2:1625783_at:190:163; Interrogation_Position=841; Antisense; AAATATTTACGTTTGTCTGCATCGG

Paste this into a BLAST search page for me
TAGAAGCCTTCATTCTAGCCGAACTGAGGATTCAGGCTTCGAGTCCGGCAATAGCACCCATGTATGAGCCATCATTAATGTTGCACCAACCTTGGGCTACATGTATGCCGGTGGACCAATTCGCCCCAATTCGCCCGCATTATGGACAATGCACGGCATTAATTAACTCGCAGTCAACTCGCAGTCTTACCTTTTGCAAAGAGCCATGTTTCGAAATGCCTTAGTGTTGGGTTTCGGTTTATTCATGTCGCATCTGTATCTGTGTGCGAGTTGCATTCTTCGAATTTACCATACGCTCTCATACGCTCTCTTGTGCAACATCAATAAATATTTACGTTTGTCTGCATCGG

Full Affymetrix probeset data:

Annotations for 1625783_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720