FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625789_at:

>probe:Drosophila_2:1625789_at:9:169; Interrogation_Position=1864; Antisense; AAATGTGCCGCAGCTGTGAGCAGCC
>probe:Drosophila_2:1625789_at:129:125; Interrogation_Position=1885; Antisense; AGCCCACGTTTAATTGCCTGTGCAG
>probe:Drosophila_2:1625789_at:373:21; Interrogation_Position=1948; Antisense; ATATATTTCCCGCAGTGGCCTACGA
>probe:Drosophila_2:1625789_at:400:599; Interrogation_Position=1975; Antisense; TGTTGTCCCGTCTGCTGGAAGTTAA
>probe:Drosophila_2:1625789_at:6:475; Interrogation_Position=1995; Antisense; GTTAATCCCCAAAAGCGTATCACCG
>probe:Drosophila_2:1625789_at:629:663; Interrogation_Position=2032; Antisense; TAAAGCATCCGTTCTTCAGCGATCA
>probe:Drosophila_2:1625789_at:475:35; Interrogation_Position=2053; Antisense; ATCAGCATCGCATTACGCCGGGAAT
>probe:Drosophila_2:1625789_at:549:97; Interrogation_Position=2148; Antisense; AGATCCAGAGAGACACTTCCTTCGT
>probe:Drosophila_2:1625789_at:476:573; Interrogation_Position=2174; Antisense; GGCGGCGCGAACTCTAAAGGCATTC
>probe:Drosophila_2:1625789_at:545:569; Interrogation_Position=2192; Antisense; GGCATTCGTATGCTATCCCATGGAA
>probe:Drosophila_2:1625789_at:325:329; Interrogation_Position=2229; Antisense; GCGTCACAGGCAGCGGGTAACATCT
>probe:Drosophila_2:1625789_at:449:491; Interrogation_Position=2245; Antisense; GTAACATCTGACTCTGATCTCCGAT
>probe:Drosophila_2:1625789_at:500:15; Interrogation_Position=2268; Antisense; ATTATCTTTGTGTGTATCCTGCCTT
>probe:Drosophila_2:1625789_at:452:561; Interrogation_Position=2312; Antisense; GGAAGAATGCATTTACCGCGGCCAC

Paste this into a BLAST search page for me
AAATGTGCCGCAGCTGTGAGCAGCCAGCCCACGTTTAATTGCCTGTGCAGATATATTTCCCGCAGTGGCCTACGATGTTGTCCCGTCTGCTGGAAGTTAAGTTAATCCCCAAAAGCGTATCACCGTAAAGCATCCGTTCTTCAGCGATCAATCAGCATCGCATTACGCCGGGAATAGATCCAGAGAGACACTTCCTTCGTGGCGGCGCGAACTCTAAAGGCATTCGGCATTCGTATGCTATCCCATGGAAGCGTCACAGGCAGCGGGTAACATCTGTAACATCTGACTCTGATCTCCGATATTATCTTTGTGTGTATCCTGCCTTGGAAGAATGCATTTACCGCGGCCAC

Full Affymetrix probeset data:

Annotations for 1625789_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720