Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625790_at:

>probe:Drosophila_2:1625790_at:352:373; Interrogation_Position=240; Antisense; GAAGTACCTGGCTCCAGCTGCAGTA
>probe:Drosophila_2:1625790_at:593:493; Interrogation_Position=289; Antisense; GTCGTTTCCCGCAAGAGCTATTCCG
>probe:Drosophila_2:1625790_at:713:125; Interrogation_Position=318; Antisense; AGCCGTGTCGCATGGATCGTACTCC
>probe:Drosophila_2:1625790_at:120:145; Interrogation_Position=368; Antisense; ACTCAGCTCCAGTTGCATCATATAG
>probe:Drosophila_2:1625790_at:493:121; Interrogation_Position=567; Antisense; AGCGGTATCCCACGGATCATCGTAC
>probe:Drosophila_2:1625790_at:613:43; Interrogation_Position=600; Antisense; ATCGCTATCCCATGGATCGTATGCC
>probe:Drosophila_2:1625790_at:664:39; Interrogation_Position=630; Antisense; ATCGGTTTCCAGCAAGACCTATGCC
>probe:Drosophila_2:1625790_at:369:117; Interrogation_Position=676; Antisense; AGCTACTCGGGTTCCAGCTCAGGAT
>probe:Drosophila_2:1625790_at:268:649; Interrogation_Position=694; Antisense; TCAGGATCTGGCCACGGATACGGAT
>probe:Drosophila_2:1625790_at:307:629; Interrogation_Position=724; Antisense; TCCAGCCATGGATCGGGAGTGCGTT
>probe:Drosophila_2:1625790_at:354:715; Interrogation_Position=747; Antisense; TTCTGGCCACGGATCTAGCTTCGGA
>probe:Drosophila_2:1625790_at:329:645; Interrogation_Position=760; Antisense; TCTAGCTTCGGATCTGGACACAAAT
>probe:Drosophila_2:1625790_at:344:165; Interrogation_Position=781; Antisense; AAATCGGGTTCCTACGCTGCCAATG
>probe:Drosophila_2:1625790_at:361:519; Interrogation_Position=806; Antisense; GTGGCTACGAGTACCGCCTAAAGCA

Paste this into a BLAST search page for me
GAAGTACCTGGCTCCAGCTGCAGTAGTCGTTTCCCGCAAGAGCTATTCCGAGCCGTGTCGCATGGATCGTACTCCACTCAGCTCCAGTTGCATCATATAGAGCGGTATCCCACGGATCATCGTACATCGCTATCCCATGGATCGTATGCCATCGGTTTCCAGCAAGACCTATGCCAGCTACTCGGGTTCCAGCTCAGGATTCAGGATCTGGCCACGGATACGGATTCCAGCCATGGATCGGGAGTGCGTTTTCTGGCCACGGATCTAGCTTCGGATCTAGCTTCGGATCTGGACACAAATAAATCGGGTTCCTACGCTGCCAATGGTGGCTACGAGTACCGCCTAAAGCA

Full Affymetrix probeset data:

Annotations for 1625790_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime