Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625792_s_at:

>probe:Drosophila_2:1625792_s_at:159:421; Interrogation_Position=1052; Antisense; GAGCACCAATAGATAGCCGACTTAG
>probe:Drosophila_2:1625792_s_at:683:605; Interrogation_Position=1089; Antisense; TGATGCCGACATTTTCATGAAATTA
>probe:Drosophila_2:1625792_s_at:32:275; Interrogation_Position=540; Antisense; CTTGCGAGGGCAAACCTAATGGTGA
>probe:Drosophila_2:1625792_s_at:696:99; Interrogation_Position=574; Antisense; AGAGGCTGAGCTTGGCCCAGACTAC
>probe:Drosophila_2:1625792_s_at:489:103; Interrogation_Position=592; Antisense; AGACTACTCCGGATTGCGACGACTA
>probe:Drosophila_2:1625792_s_at:588:143; Interrogation_Position=625; Antisense; ACTCGAATCTCAGTTTGAACGCCGT
>probe:Drosophila_2:1625792_s_at:638:613; Interrogation_Position=640; Antisense; TGAACGCCGTGAATGGCACGCGACT
>probe:Drosophila_2:1625792_s_at:413:355; Interrogation_Position=668; Antisense; GCACATTCAGCCGATTCCAAAGAGG
>probe:Drosophila_2:1625792_s_at:252:413; Interrogation_Position=698; Antisense; GACCGTCCTGGACAAGCAGTCCATG
>probe:Drosophila_2:1625792_s_at:326:543; Interrogation_Position=722; Antisense; GGATATTTACTTGATGGGAACCACA
>probe:Drosophila_2:1625792_s_at:44:427; Interrogation_Position=864; Antisense; GAGATGTTAGCTTGGCAGGAGCCAC
>probe:Drosophila_2:1625792_s_at:326:127; Interrogation_Position=883; Antisense; AGCCACAGAAAGATAGCCGCCATTT
>probe:Drosophila_2:1625792_s_at:522:123; Interrogation_Position=897; Antisense; AGCCGCCATTTGGAGATTTCCTTGA
>probe:Drosophila_2:1625792_s_at:348:225; Interrogation_Position=988; Antisense; AAGGCACCACTGGAAGAGGTTCACA

Paste this into a BLAST search page for me
GAGCACCAATAGATAGCCGACTTAGTGATGCCGACATTTTCATGAAATTACTTGCGAGGGCAAACCTAATGGTGAAGAGGCTGAGCTTGGCCCAGACTACAGACTACTCCGGATTGCGACGACTAACTCGAATCTCAGTTTGAACGCCGTTGAACGCCGTGAATGGCACGCGACTGCACATTCAGCCGATTCCAAAGAGGGACCGTCCTGGACAAGCAGTCCATGGGATATTTACTTGATGGGAACCACAGAGATGTTAGCTTGGCAGGAGCCACAGCCACAGAAAGATAGCCGCCATTTAGCCGCCATTTGGAGATTTCCTTGAAAGGCACCACTGGAAGAGGTTCACA

Full Affymetrix probeset data:

Annotations for 1625792_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime