Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625793_at:

>probe:Drosophila_2:1625793_at:317:399; Interrogation_Position=2329; Antisense; GACACATTTATGGAACGCTCCGCGA
>probe:Drosophila_2:1625793_at:293:19; Interrogation_Position=2353; Antisense; ATTTGGCCAGCCTGTACCATAGTGT
>probe:Drosophila_2:1625793_at:441:329; Interrogation_Position=2383; Antisense; GCGTGGTGACGCTCAGCTTCAAGAA
>probe:Drosophila_2:1625793_at:477:425; Interrogation_Position=2416; Antisense; GAGACCAAATATACGACTTCAACAA
>probe:Drosophila_2:1625793_at:83:187; Interrogation_Position=2436; Antisense; AACAAGCGATTCATGCTCACCGGTA
>probe:Drosophila_2:1625793_at:287:53; Interrogation_Position=2448; Antisense; ATGCTCACCGGTAGTCACATCGACG
>probe:Drosophila_2:1625793_at:188:631; Interrogation_Position=2476; Antisense; TCCTCTTTCTTCATCATCACAACAA
>probe:Drosophila_2:1625793_at:320:257; Interrogation_Position=2493; Antisense; CACAACAATTAGTCTGCACTGGCGA
>probe:Drosophila_2:1625793_at:617:355; Interrogation_Position=2508; Antisense; GCACTGGCGACTACTGTTTCTTATA
>probe:Drosophila_2:1625793_at:250:139; Interrogation_Position=2559; Antisense; ACGTAATCCGATCTTGTGTATATGA
>probe:Drosophila_2:1625793_at:178:669; Interrogation_Position=2615; Antisense; TAGCGATTCCGCAGTACTTTTAACC
>probe:Drosophila_2:1625793_at:191:399; Interrogation_Position=2644; Antisense; GACAGCCTTGGGACGTACACGGAAC
>probe:Drosophila_2:1625793_at:24:23; Interrogation_Position=2775; Antisense; ATATCACGCTTATCAAGCTCACTTG
>probe:Drosophila_2:1625793_at:706:117; Interrogation_Position=2790; Antisense; AGCTCACTTGTAAATCCCCTTATAT

Paste this into a BLAST search page for me
GACACATTTATGGAACGCTCCGCGAATTTGGCCAGCCTGTACCATAGTGTGCGTGGTGACGCTCAGCTTCAAGAAGAGACCAAATATACGACTTCAACAAAACAAGCGATTCATGCTCACCGGTAATGCTCACCGGTAGTCACATCGACGTCCTCTTTCTTCATCATCACAACAACACAACAATTAGTCTGCACTGGCGAGCACTGGCGACTACTGTTTCTTATAACGTAATCCGATCTTGTGTATATGATAGCGATTCCGCAGTACTTTTAACCGACAGCCTTGGGACGTACACGGAACATATCACGCTTATCAAGCTCACTTGAGCTCACTTGTAAATCCCCTTATAT

Full Affymetrix probeset data:

Annotations for 1625793_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime