FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625794_at:

>probe:Drosophila_2:1625794_at:287:135; Interrogation_Position=2976; Antisense; ACGCCGAAATCCCACCTGATAAATA
>probe:Drosophila_2:1625794_at:28:411; Interrogation_Position=3017; Antisense; GACGCTATTGCTATCCGAAACACAT
>probe:Drosophila_2:1625794_at:119:31; Interrogation_Position=3040; Antisense; ATACACGATTCGCTCACAGACCAGT
>probe:Drosophila_2:1625794_at:50:413; Interrogation_Position=3058; Antisense; GACCAGTCCAGACAGAACTCTTTTT
>probe:Drosophila_2:1625794_at:40:193; Interrogation_Position=3073; Antisense; AACTCTTTTTATCTTTTTCTCTATG
>probe:Drosophila_2:1625794_at:581:249; Interrogation_Position=3104; Antisense; CAATGTCTTGTATTTCTCAACTAAC
>probe:Drosophila_2:1625794_at:9:281; Interrogation_Position=3124; Antisense; CTAACTTTTGCAACCATTCTTTTAT
>probe:Drosophila_2:1625794_at:725:697; Interrogation_Position=3148; Antisense; TTTAGTGCATAAGCCATTGTGTTTC
>probe:Drosophila_2:1625794_at:161:315; Interrogation_Position=3160; Antisense; GCCATTGTGTTTCTAATTTGCTTAG
>probe:Drosophila_2:1625794_at:98:161; Interrogation_Position=3215; Antisense; AAATTGGCACGTTGCAAACGCGCGC
>probe:Drosophila_2:1625794_at:263:177; Interrogation_Position=3230; Antisense; AAACGCGCGCGATATTCTCATATTT
>probe:Drosophila_2:1625794_at:620:601; Interrogation_Position=3305; Antisense; TGTATATCATTTACACCCGCTGCAA
>probe:Drosophila_2:1625794_at:703:703; Interrogation_Position=3315; Antisense; TTACACCCGCTGCAAAAGTCTAAGG
>probe:Drosophila_2:1625794_at:89:49; Interrogation_Position=3382; Antisense; AGCAGTAAATCGCAAGAACTCGTTT

Paste this into a BLAST search page for me
ACGCCGAAATCCCACCTGATAAATAGACGCTATTGCTATCCGAAACACATATACACGATTCGCTCACAGACCAGTGACCAGTCCAGACAGAACTCTTTTTAACTCTTTTTATCTTTTTCTCTATGCAATGTCTTGTATTTCTCAACTAACCTAACTTTTGCAACCATTCTTTTATTTTAGTGCATAAGCCATTGTGTTTCGCCATTGTGTTTCTAATTTGCTTAGAAATTGGCACGTTGCAAACGCGCGCAAACGCGCGCGATATTCTCATATTTTGTATATCATTTACACCCGCTGCAATTACACCCGCTGCAAAAGTCTAAGGAGCAGTAAATCGCAAGAACTCGTTT

Full Affymetrix probeset data:

Annotations for 1625794_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720