FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625796_at:

>probe:Drosophila_2:1625796_at:177:91; Interrogation_Position=1044; Antisense; AGTATGGCTGCAGGAGCTTCCGTCC
>probe:Drosophila_2:1625796_at:107:45; Interrogation_Position=1069; Antisense; ATCGAAGCGGTACTGCTCCGACAAC
>probe:Drosophila_2:1625796_at:722:29; Interrogation_Position=1137; Antisense; ATAAAGAGGCCAGCACGCGCTACGA
>probe:Drosophila_2:1625796_at:549:399; Interrogation_Position=1166; Antisense; GACAGCATTGATATCCAGGGCAGCG
>probe:Drosophila_2:1625796_at:406:665; Interrogation_Position=1251; Antisense; TACAGCCACTGGTTTGATCACTAGC
>probe:Drosophila_2:1625796_at:209:145; Interrogation_Position=1270; Antisense; ACTAGCCCCTGTTGTGTTTTATACA
>probe:Drosophila_2:1625796_at:458:367; Interrogation_Position=1316; Antisense; GAATCCTTGTTCGTTGTTGAATCCT
>probe:Drosophila_2:1625796_at:79:473; Interrogation_Position=1394; Antisense; GTTCTTTGGCGCTGCAGAGTTCCTA
>probe:Drosophila_2:1625796_at:187:101; Interrogation_Position=1409; Antisense; AGAGTTCCTACTTGCTAAGAGCCAC
>probe:Drosophila_2:1625796_at:558:723; Interrogation_Position=1435; Antisense; TTGCTAGCTCTGGTGGCTTCCGAGA
>probe:Drosophila_2:1625796_at:517:427; Interrogation_Position=1456; Antisense; GAGATCTCGACGTTTATGCTGACGA
>probe:Drosophila_2:1625796_at:462:227; Interrogation_Position=1522; Antisense; AATGGAAAAGCTTTGCCTCCACCTG
>probe:Drosophila_2:1625796_at:598:603; Interrogation_Position=1545; Antisense; TGTTGGCCACTTTTCCAGGAACGTA
>probe:Drosophila_2:1625796_at:66:411; Interrogation_Position=1581; Antisense; GACGACAGGTCTTTATCACGCGAAT

Paste this into a BLAST search page for me
AGTATGGCTGCAGGAGCTTCCGTCCATCGAAGCGGTACTGCTCCGACAACATAAAGAGGCCAGCACGCGCTACGAGACAGCATTGATATCCAGGGCAGCGTACAGCCACTGGTTTGATCACTAGCACTAGCCCCTGTTGTGTTTTATACAGAATCCTTGTTCGTTGTTGAATCCTGTTCTTTGGCGCTGCAGAGTTCCTAAGAGTTCCTACTTGCTAAGAGCCACTTGCTAGCTCTGGTGGCTTCCGAGAGAGATCTCGACGTTTATGCTGACGAAATGGAAAAGCTTTGCCTCCACCTGTGTTGGCCACTTTTCCAGGAACGTAGACGACAGGTCTTTATCACGCGAAT

Full Affymetrix probeset data:

Annotations for 1625796_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720