FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625797_at:

>probe:Drosophila_2:1625797_at:3:675; Interrogation_Position=1000; Antisense; TACCATCGAATGTTTGCGCCCAAGT
>probe:Drosophila_2:1625797_at:3:179; Interrogation_Position=1070; Antisense; AAACTGTGCGCGTCGTCTCGATGGA
>probe:Drosophila_2:1625797_at:265:67; Interrogation_Position=1090; Antisense; ATGGACAAGGACTTCCACGTGGACT
>probe:Drosophila_2:1625797_at:218:141; Interrogation_Position=1106; Antisense; ACGTGGACTGCTACATCTGCGAGGA
>probe:Drosophila_2:1625797_at:234:87; Interrogation_Position=1130; Antisense; AGTGCGGCATGCAGCTGACCGATGA
>probe:Drosophila_2:1625797_at:30:443; Interrogation_Position=1150; Antisense; GATGAGCCGGACAAACGCTGTTACC
>probe:Drosophila_2:1625797_at:376:499; Interrogation_Position=1261; Antisense; GTCTGCGCTTCGTACCAGTATATGG
>probe:Drosophila_2:1625797_at:399:413; Interrogation_Position=1341; Antisense; GACCTTCGACTGAGTGGCGCACAAA
>probe:Drosophila_2:1625797_at:75:185; Interrogation_Position=839; Antisense; AAAAGTGCGCCATCTGTGGCCATCT
>probe:Drosophila_2:1625797_at:489:559; Interrogation_Position=870; Antisense; GGAAATGATCTTGCAGGCCATGGGC
>probe:Drosophila_2:1625797_at:537:579; Interrogation_Position=885; Antisense; GGCCATGGGCAAGTCGTATCATCCG
>probe:Drosophila_2:1625797_at:368:343; Interrogation_Position=914; Antisense; GCTTCCGGTGCTGTGTGTGCAATGA
>probe:Drosophila_2:1625797_at:163:409; Interrogation_Position=967; Antisense; GACGTGGACCACAAGATCTACTGCG
>probe:Drosophila_2:1625797_at:549:669; Interrogation_Position=985; Antisense; TACTGCGTCAACGACTACCATCGAA

Paste this into a BLAST search page for me
TACCATCGAATGTTTGCGCCCAAGTAAACTGTGCGCGTCGTCTCGATGGAATGGACAAGGACTTCCACGTGGACTACGTGGACTGCTACATCTGCGAGGAAGTGCGGCATGCAGCTGACCGATGAGATGAGCCGGACAAACGCTGTTACCGTCTGCGCTTCGTACCAGTATATGGGACCTTCGACTGAGTGGCGCACAAAAAAAGTGCGCCATCTGTGGCCATCTGGAAATGATCTTGCAGGCCATGGGCGGCCATGGGCAAGTCGTATCATCCGGCTTCCGGTGCTGTGTGTGCAATGAGACGTGGACCACAAGATCTACTGCGTACTGCGTCAACGACTACCATCGAA

Full Affymetrix probeset data:

Annotations for 1625797_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720