FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625800_at:

>probe:Drosophila_2:1625800_at:646:361; Interrogation_Position=303; Antisense; GAATTACCAACTCACTTGCACTGTA
>probe:Drosophila_2:1625800_at:55:205; Interrogation_Position=347; Antisense; AAGCCACGACCAAAATCCAGCAGTT
>probe:Drosophila_2:1625800_at:215:31; Interrogation_Position=381; Antisense; ATACAAACCGGTGCCTCTAAGCGAG
>probe:Drosophila_2:1625800_at:173:369; Interrogation_Position=456; Antisense; GAATGCCAGCGCCAAGGAGAGACTT
>probe:Drosophila_2:1625800_at:628:425; Interrogation_Position=472; Antisense; GAGAGACTTTCCATGCCGAGATTCC
>probe:Drosophila_2:1625800_at:683:427; Interrogation_Position=489; Antisense; GAGATTCCTTATAACTGGGCGCCTG
>probe:Drosophila_2:1625800_at:121:323; Interrogation_Position=507; Antisense; GCGCCTGGACCGGAGTGAATTCTGC
>probe:Drosophila_2:1625800_at:383:363; Interrogation_Position=523; Antisense; GAATTCTGCGTAACAACTCCGATTA
>probe:Drosophila_2:1625800_at:348:461; Interrogation_Position=543; Antisense; GATTACTGGCAGCATTACGGTGCAA
>probe:Drosophila_2:1625800_at:393:439; Interrogation_Position=574; Antisense; GAGGCGGCCATTAAGTCCATTGAGA
>probe:Drosophila_2:1625800_at:528:411; Interrogation_Position=666; Antisense; GACCATTCAAATAGCCGACGGCAAT
>probe:Drosophila_2:1625800_at:431:487; Interrogation_Position=691; Antisense; GTACTGCCGAAGCTAGAACTACCCA
>probe:Drosophila_2:1625800_at:722:47; Interrogation_Position=715; Antisense; ATCCATATGGTCCTGCCCAGATTGT
>probe:Drosophila_2:1625800_at:320:625; Interrogation_Position=745; Antisense; TGCCCTACGTTGCTCACGAAGAACT

Paste this into a BLAST search page for me
GAATTACCAACTCACTTGCACTGTAAAGCCACGACCAAAATCCAGCAGTTATACAAACCGGTGCCTCTAAGCGAGGAATGCCAGCGCCAAGGAGAGACTTGAGAGACTTTCCATGCCGAGATTCCGAGATTCCTTATAACTGGGCGCCTGGCGCCTGGACCGGAGTGAATTCTGCGAATTCTGCGTAACAACTCCGATTAGATTACTGGCAGCATTACGGTGCAAGAGGCGGCCATTAAGTCCATTGAGAGACCATTCAAATAGCCGACGGCAATGTACTGCCGAAGCTAGAACTACCCAATCCATATGGTCCTGCCCAGATTGTTGCCCTACGTTGCTCACGAAGAACT

Full Affymetrix probeset data:

Annotations for 1625800_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720