Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625801_s_at:

>probe:Drosophila_2:1625801_s_at:324:451; Interrogation_Position=1000; Antisense; GATCTGTTGCTGATTTGATTCGCGG
>probe:Drosophila_2:1625801_s_at:698:491; Interrogation_Position=1075; Antisense; GTAACACTCTCTTTAACCTATTGGA
>probe:Drosophila_2:1625801_s_at:441:527; Interrogation_Position=1097; Antisense; GGAGTAACACTTGATTTCACTTTAA
>probe:Drosophila_2:1625801_s_at:84:411; Interrogation_Position=595; Antisense; GACGACATTATCTCATGGGATGCAG
>probe:Drosophila_2:1625801_s_at:231:83; Interrogation_Position=638; Antisense; AGGGCACACTGTTTGAGCTGATATT
>probe:Drosophila_2:1625801_s_at:654:459; Interrogation_Position=657; Antisense; GATATTGGCAGCGAACTATCTGGAC
>probe:Drosophila_2:1625801_s_at:412:277; Interrogation_Position=672; Antisense; CTATCTGGACATTAAGGGCCTTCTG
>probe:Drosophila_2:1625801_s_at:142:287; Interrogation_Position=694; Antisense; CTGGAGCTCACCTGCAAGACTGTTG
>probe:Drosophila_2:1625801_s_at:657:557; Interrogation_Position=747; Antisense; GGAAATACGCAAGACCTTCAACATT
>probe:Drosophila_2:1625801_s_at:415:651; Interrogation_Position=771; Antisense; TAAGAAGGACTTTTCGCCCGCCGAG
>probe:Drosophila_2:1625801_s_at:549:569; Interrogation_Position=846; Antisense; GGCATTTCGCGGGACCAACATTAAG
>probe:Drosophila_2:1625801_s_at:692:197; Interrogation_Position=894; Antisense; AACGAATTGGATTTGCAGCATTGCA
>probe:Drosophila_2:1625801_s_at:627:677; Interrogation_Position=927; Antisense; TAGTTGCTACTTTCATTTACATTTT
>probe:Drosophila_2:1625801_s_at:97:701; Interrogation_Position=959; Antisense; TTTTAACCCCAGCAGAGACTCGATT

Paste this into a BLAST search page for me
GATCTGTTGCTGATTTGATTCGCGGGTAACACTCTCTTTAACCTATTGGAGGAGTAACACTTGATTTCACTTTAAGACGACATTATCTCATGGGATGCAGAGGGCACACTGTTTGAGCTGATATTGATATTGGCAGCGAACTATCTGGACCTATCTGGACATTAAGGGCCTTCTGCTGGAGCTCACCTGCAAGACTGTTGGGAAATACGCAAGACCTTCAACATTTAAGAAGGACTTTTCGCCCGCCGAGGGCATTTCGCGGGACCAACATTAAGAACGAATTGGATTTGCAGCATTGCATAGTTGCTACTTTCATTTACATTTTTTTTAACCCCAGCAGAGACTCGATT

Full Affymetrix probeset data:

Annotations for 1625801_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime