Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625806_at:

>probe:Drosophila_2:1625806_at:303:255; Interrogation_Position=1681; Antisense; CACAAATCGAGACACTTTAGTTCAA
>probe:Drosophila_2:1625806_at:701:359; Interrogation_Position=1734; Antisense; GCAAGAATATTTTATCTCCTAATGT
>probe:Drosophila_2:1625806_at:697:649; Interrogation_Position=1772; Antisense; TAATATTTCCTTGCGCAAAACCCAC
>probe:Drosophila_2:1625806_at:150:271; Interrogation_Position=1818; Antisense; CATACACATGCTCAGATCATCCGTA
>probe:Drosophila_2:1625806_at:120:621; Interrogation_Position=1826; Antisense; TGCTCAGATCATCCGTACAGTAGGT
>probe:Drosophila_2:1625806_at:431:265; Interrogation_Position=1843; Antisense; CAGTAGGTACCATAAGTGCACGCAC
>probe:Drosophila_2:1625806_at:599:509; Interrogation_Position=1858; Antisense; GTGCACGCACCGGTTGTATTTTAAT
>probe:Drosophila_2:1625806_at:197:655; Interrogation_Position=1879; Antisense; TAATTTGCATTTCCAACTCGCACAG
>probe:Drosophila_2:1625806_at:637:693; Interrogation_Position=1888; Antisense; TTTCCAACTCGCACAGCATTTTAAT
>probe:Drosophila_2:1625806_at:564:697; Interrogation_Position=1906; Antisense; TTTTAATTATGTATGCCGATCCTGG
>probe:Drosophila_2:1625806_at:290:447; Interrogation_Position=1923; Antisense; GATCCTGGCGGCACCTTTGGCAAAG
>probe:Drosophila_2:1625806_at:503:583; Interrogation_Position=1940; Antisense; TGGCAAAGGTCTTTAACCACACTTC
>probe:Drosophila_2:1625806_at:711:271; Interrogation_Position=2092; Antisense; CATATGTATGTACTCGAAGCACGAT
>probe:Drosophila_2:1625806_at:724:253; Interrogation_Position=2193; Antisense; CAAAAGCTTGAATTGTTTACACCAA

Paste this into a BLAST search page for me
CACAAATCGAGACACTTTAGTTCAAGCAAGAATATTTTATCTCCTAATGTTAATATTTCCTTGCGCAAAACCCACCATACACATGCTCAGATCATCCGTATGCTCAGATCATCCGTACAGTAGGTCAGTAGGTACCATAAGTGCACGCACGTGCACGCACCGGTTGTATTTTAATTAATTTGCATTTCCAACTCGCACAGTTTCCAACTCGCACAGCATTTTAATTTTTAATTATGTATGCCGATCCTGGGATCCTGGCGGCACCTTTGGCAAAGTGGCAAAGGTCTTTAACCACACTTCCATATGTATGTACTCGAAGCACGATCAAAAGCTTGAATTGTTTACACCAA

Full Affymetrix probeset data:

Annotations for 1625806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime