FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625813_at:

>probe:Drosophila_2:1625813_at:133:367; Interrogation_Position=3238; Antisense; GAATCTTTGCGAATCTGGAGCTAAA
>probe:Drosophila_2:1625813_at:316:171; Interrogation_Position=3269; Antisense; AAAGTACTTGGCCAGCTTGTATTTC
>probe:Drosophila_2:1625813_at:98:75; Interrogation_Position=3313; Antisense; AGGACCTGCGCGATGAGTTTGAACC
>probe:Drosophila_2:1625813_at:311:479; Interrogation_Position=3329; Antisense; GTTTGAACCGCTGCAGGACTGTGTC
>probe:Drosophila_2:1625813_at:484:259; Interrogation_Position=3362; Antisense; CACTGACTCCGCTGGAAACCTAAAA
>probe:Drosophila_2:1625813_at:359:143; Interrogation_Position=3419; Antisense; ACTGGTTTTGGCTATGCGTGCATAT
>probe:Drosophila_2:1625813_at:361:563; Interrogation_Position=3454; Antisense; GGAATCCACGACATGTTGACTACAG
>probe:Drosophila_2:1625813_at:173:71; Interrogation_Position=3550; Antisense; AGGCCTGTAAGCTTCGCTGGCAGAT
>probe:Drosophila_2:1625813_at:703:341; Interrogation_Position=3585; Antisense; GCTTACGAGTGTTACCTACGCGAGA
>probe:Drosophila_2:1625813_at:231:315; Interrogation_Position=3616; Antisense; GCCATCCGCGTGTCAACGAACGAAA
>probe:Drosophila_2:1625813_at:275:393; Interrogation_Position=3637; Antisense; GAAAGTTGCAGAAGTTGCGCTCCAA
>probe:Drosophila_2:1625813_at:632:425; Interrogation_Position=3675; Antisense; GAGATGCGCTTCCTCAACATTTAGT
>probe:Drosophila_2:1625813_at:492:313; Interrogation_Position=3703; Antisense; GACATTCCAGTCTCGTTTTAGGCTA
>probe:Drosophila_2:1625813_at:354:19; Interrogation_Position=3772; Antisense; ATTTGCCAACTTTTCTAGGAGCTTA

Paste this into a BLAST search page for me
GAATCTTTGCGAATCTGGAGCTAAAAAAGTACTTGGCCAGCTTGTATTTCAGGACCTGCGCGATGAGTTTGAACCGTTTGAACCGCTGCAGGACTGTGTCCACTGACTCCGCTGGAAACCTAAAAACTGGTTTTGGCTATGCGTGCATATGGAATCCACGACATGTTGACTACAGAGGCCTGTAAGCTTCGCTGGCAGATGCTTACGAGTGTTACCTACGCGAGAGCCATCCGCGTGTCAACGAACGAAAGAAAGTTGCAGAAGTTGCGCTCCAAGAGATGCGCTTCCTCAACATTTAGTGACATTCCAGTCTCGTTTTAGGCTAATTTGCCAACTTTTCTAGGAGCTTA

Full Affymetrix probeset data:

Annotations for 1625813_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720