Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625814_at:

>probe:Drosophila_2:1625814_at:417:691; Interrogation_Position=2249; Antisense; TTTGGTTTCCACCATGTTTCGATGC
>probe:Drosophila_2:1625814_at:708:59; Interrogation_Position=2262; Antisense; ATGTTTCGATGCTTCTCCGTTTGTC
>probe:Drosophila_2:1625814_at:378:479; Interrogation_Position=2280; Antisense; GTTTGTCTTCTGTGCGGGATTACCC
>probe:Drosophila_2:1625814_at:198:529; Interrogation_Position=2295; Antisense; GGGATTACCCGATCTTTAAGCCATA
>probe:Drosophila_2:1625814_at:699:451; Interrogation_Position=2305; Antisense; GATCTTTAAGCCATATACCACGCCC
>probe:Drosophila_2:1625814_at:267:599; Interrogation_Position=2337; Antisense; TGATCCAACCCAAAATGTCGAAATG
>probe:Drosophila_2:1625814_at:647:211; Interrogation_Position=2406; Antisense; AAGAGGCATGCGCATCTCGAACGTT
>probe:Drosophila_2:1625814_at:23:625; Interrogation_Position=2414; Antisense; TGCGCATCTCGAACGTTGACGACAA
>probe:Drosophila_2:1625814_at:512:483; Interrogation_Position=2504; Antisense; GTATGTTAACAAGCAATCCGGTCGG
>probe:Drosophila_2:1625814_at:362:47; Interrogation_Position=2519; Antisense; ATCCGGTCGGAAATTGTTGTTCAAG
>probe:Drosophila_2:1625814_at:182:153; Interrogation_Position=2565; Antisense; ACATGATCATATTTTGCCAAGCCGA
>probe:Drosophila_2:1625814_at:721:311; Interrogation_Position=2580; Antisense; GCCAAGCCGACTGCAATGAGCATGT
>probe:Drosophila_2:1625814_at:618:559; Interrogation_Position=2611; Antisense; GGAAGTTAAGCTCCGTACGCCTACA
>probe:Drosophila_2:1625814_at:152:489; Interrogation_Position=2625; Antisense; GTACGCCTACAGATCGATGTTCTAA

Paste this into a BLAST search page for me
TTTGGTTTCCACCATGTTTCGATGCATGTTTCGATGCTTCTCCGTTTGTCGTTTGTCTTCTGTGCGGGATTACCCGGGATTACCCGATCTTTAAGCCATAGATCTTTAAGCCATATACCACGCCCTGATCCAACCCAAAATGTCGAAATGAAGAGGCATGCGCATCTCGAACGTTTGCGCATCTCGAACGTTGACGACAAGTATGTTAACAAGCAATCCGGTCGGATCCGGTCGGAAATTGTTGTTCAAGACATGATCATATTTTGCCAAGCCGAGCCAAGCCGACTGCAATGAGCATGTGGAAGTTAAGCTCCGTACGCCTACAGTACGCCTACAGATCGATGTTCTAA

Full Affymetrix probeset data:

Annotations for 1625814_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime