FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625816_at:

>probe:Drosophila_2:1625816_at:637:181; Interrogation_Position=1020; Antisense; AAAAAAGAGCTCTGCGGTCGCTGAG
>probe:Drosophila_2:1625816_at:27:537; Interrogation_Position=1035; Antisense; GGTCGCTGAGCTTTCGCGGCACTAT
>probe:Drosophila_2:1625816_at:631:681; Interrogation_Position=1057; Antisense; TATGCTGCGCACCTTTAATTCCACG
>probe:Drosophila_2:1625816_at:489:653; Interrogation_Position=1072; Antisense; TAATTCCACGCTGGCGCCGATTTTT
>probe:Drosophila_2:1625816_at:180:317; Interrogation_Position=1087; Antisense; GCCGATTTTTACTCAGCTTGCCGAA
>probe:Drosophila_2:1625816_at:496:383; Interrogation_Position=1109; Antisense; GAACTGGATCTCAACGGTCTGCCGC
>probe:Drosophila_2:1625816_at:708:511; Interrogation_Position=1140; Antisense; GTGACTGCGAGCTCGTCTGGCTGAA
>probe:Drosophila_2:1625816_at:76:583; Interrogation_Position=1157; Antisense; TGGCTGAAGCAGCTGCCGGTCCAAA
>probe:Drosophila_2:1625816_at:84:671; Interrogation_Position=1280; Antisense; TACGGCCTGGTGGTGCTCTCACTGA
>probe:Drosophila_2:1625816_at:645:451; Interrogation_Position=1324; Antisense; GATCTACCTGATCGTCATGGGACTG
>probe:Drosophila_2:1625816_at:693:43; Interrogation_Position=1415; Antisense; ATCGAGCCCAATCGCCAGGAGAATC
>probe:Drosophila_2:1625816_at:318:73; Interrogation_Position=1431; Antisense; AGGAGAATCCCCACTAGGTGTCGCC
>probe:Drosophila_2:1625816_at:329:487; Interrogation_Position=1458; Antisense; GTACCTAGTACCGTCTAAGTTCTTG
>probe:Drosophila_2:1625816_at:195:259; Interrogation_Position=974; Antisense; CACTTGGACGCGGAGGCCTTTGGAC

Paste this into a BLAST search page for me
AAAAAAGAGCTCTGCGGTCGCTGAGGGTCGCTGAGCTTTCGCGGCACTATTATGCTGCGCACCTTTAATTCCACGTAATTCCACGCTGGCGCCGATTTTTGCCGATTTTTACTCAGCTTGCCGAAGAACTGGATCTCAACGGTCTGCCGCGTGACTGCGAGCTCGTCTGGCTGAATGGCTGAAGCAGCTGCCGGTCCAAATACGGCCTGGTGGTGCTCTCACTGAGATCTACCTGATCGTCATGGGACTGATCGAGCCCAATCGCCAGGAGAATCAGGAGAATCCCCACTAGGTGTCGCCGTACCTAGTACCGTCTAAGTTCTTGCACTTGGACGCGGAGGCCTTTGGAC

Full Affymetrix probeset data:

Annotations for 1625816_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720