FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625817_at:

>probe:Drosophila_2:1625817_at:197:585; Interrogation_Position=1247; Antisense; TGGAATATGGTTATGCGCCTTCGCA
>probe:Drosophila_2:1625817_at:598:119; Interrogation_Position=1271; Antisense; AGCTGCTCCTCAATGGCTATTGTGC
>probe:Drosophila_2:1625817_at:258:3; Interrogation_Position=1289; Antisense; ATTGTGCCGCCATGGTAGATGACGC
>probe:Drosophila_2:1625817_at:440:355; Interrogation_Position=1325; Antisense; GCACTCCGTCCATTGAGCCAGATAA
>probe:Drosophila_2:1625817_at:670:225; Interrogation_Position=1352; Antisense; AAGGCGTCGCCATTACAGCGGATCA
>probe:Drosophila_2:1625817_at:64:211; Interrogation_Position=1390; Antisense; AAGCACAAGTCCGTTGAGGCTCTGC
>probe:Drosophila_2:1625817_at:163:439; Interrogation_Position=1405; Antisense; GAGGCTCTGCATTCCGACGATGGAA
>probe:Drosophila_2:1625817_at:265:409; Interrogation_Position=1420; Antisense; GACGATGGAATGTCCTCGCTTTCAA
>probe:Drosophila_2:1625817_at:635:549; Interrogation_Position=1446; Antisense; GGAGTCCGTGGATTCGTCTGTGTAC
>probe:Drosophila_2:1625817_at:242:489; Interrogation_Position=1467; Antisense; GTACGGTGCAGATGTGCAGCCCGAT
>probe:Drosophila_2:1625817_at:347:195; Interrogation_Position=1531; Antisense; AACTGTGGATTGAGCAGCCGCTGCA
>probe:Drosophila_2:1625817_at:477:391; Interrogation_Position=1644; Antisense; GAAAGCACTTCACGATCTGGACATG
>probe:Drosophila_2:1625817_at:228:587; Interrogation_Position=1661; Antisense; TGGACATGCGGGACTACGAGGCTAT
>probe:Drosophila_2:1625817_at:11:115; Interrogation_Position=1698; Antisense; AGCAGAGAATCTGGCGGCTATTCCT

Paste this into a BLAST search page for me
TGGAATATGGTTATGCGCCTTCGCAAGCTGCTCCTCAATGGCTATTGTGCATTGTGCCGCCATGGTAGATGACGCGCACTCCGTCCATTGAGCCAGATAAAAGGCGTCGCCATTACAGCGGATCAAAGCACAAGTCCGTTGAGGCTCTGCGAGGCTCTGCATTCCGACGATGGAAGACGATGGAATGTCCTCGCTTTCAAGGAGTCCGTGGATTCGTCTGTGTACGTACGGTGCAGATGTGCAGCCCGATAACTGTGGATTGAGCAGCCGCTGCAGAAAGCACTTCACGATCTGGACATGTGGACATGCGGGACTACGAGGCTATAGCAGAGAATCTGGCGGCTATTCCT

Full Affymetrix probeset data:

Annotations for 1625817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720