FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625818_at:

>probe:Drosophila_2:1625818_at:285:313; Interrogation_Position=136; Antisense; GCCACTCAGCTGACCGATCTGTTAA
>probe:Drosophila_2:1625818_at:116:281; Interrogation_Position=140; Antisense; CTCAGCTGACCGATCTGTTAAACAG
>probe:Drosophila_2:1625818_at:714:445; Interrogation_Position=151; Antisense; GATCTGTTAAACAGCCTGAAGGGCA
>probe:Drosophila_2:1625818_at:392:253; Interrogation_Position=228; Antisense; CACGGTAACGACCTCGCCAACTGGA
>probe:Drosophila_2:1625818_at:57:337; Interrogation_Position=325; Antisense; GCTCGCCAATTGGAGCCGCTCGATG
>probe:Drosophila_2:1625818_at:245:249; Interrogation_Position=332; Antisense; AATTGGAGCCGCTCGATGATCAGGA
>probe:Drosophila_2:1625818_at:477:123; Interrogation_Position=338; Antisense; AGCCGCTCGATGATCAGGAGGACGA
>probe:Drosophila_2:1625818_at:381:549; Interrogation_Position=369; Antisense; GGAGGAGCAACAATTGGGCCACCAT
>probe:Drosophila_2:1625818_at:643:185; Interrogation_Position=377; Antisense; AACAATTGGGCCACCATCAGCGCTT
>probe:Drosophila_2:1625818_at:141:35; Interrogation_Position=392; Antisense; ATCAGCGCTTCCAGCTGGAGGATCA
>probe:Drosophila_2:1625818_at:251:275; Interrogation_Position=399; Antisense; CTTCCAGCTGGAGGATCAGAACGAT
>probe:Drosophila_2:1625818_at:90:77; Interrogation_Position=431; Antisense; AGGAGCATACCCAGGTGGCCCGCTC
>probe:Drosophila_2:1625818_at:558:123; Interrogation_Position=602; Antisense; AGCGCCGCAGGAGGCAGCAGAACCA
>probe:Drosophila_2:1625818_at:389:567; Interrogation_Position=614; Antisense; GGCAGCAGAACCAGAGGCGCCGCCA

Paste this into a BLAST search page for me
GCCACTCAGCTGACCGATCTGTTAACTCAGCTGACCGATCTGTTAAACAGGATCTGTTAAACAGCCTGAAGGGCACACGGTAACGACCTCGCCAACTGGAGCTCGCCAATTGGAGCCGCTCGATGAATTGGAGCCGCTCGATGATCAGGAAGCCGCTCGATGATCAGGAGGACGAGGAGGAGCAACAATTGGGCCACCATAACAATTGGGCCACCATCAGCGCTTATCAGCGCTTCCAGCTGGAGGATCACTTCCAGCTGGAGGATCAGAACGATAGGAGCATACCCAGGTGGCCCGCTCAGCGCCGCAGGAGGCAGCAGAACCAGGCAGCAGAACCAGAGGCGCCGCCA

Full Affymetrix probeset data:

Annotations for 1625818_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720