FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625822_at:

>probe:Drosophila_2:1625822_at:9:385; Interrogation_Position=3088; Antisense; GAACTTTGGCTTACAGATCGTATGA
>probe:Drosophila_2:1625822_at:250:11; Interrogation_Position=3112; Antisense; ATTCTATTGTTCTATCCGTGTTCCT
>probe:Drosophila_2:1625822_at:596:513; Interrogation_Position=3129; Antisense; GTGTTCCTATCCACCAAATCAGATT
>probe:Drosophila_2:1625822_at:689:345; Interrogation_Position=3158; Antisense; GCATTTGTGTAATCGCCTTGTTGGC
>probe:Drosophila_2:1625822_at:155:167; Interrogation_Position=3185; Antisense; AAATGCCCAACGAGATTGTCCCGAT
>probe:Drosophila_2:1625822_at:559:465; Interrogation_Position=3198; Antisense; GATTGTCCCGATACCACAAGTTGTA
>probe:Drosophila_2:1625822_at:679:587; Interrogation_Position=3267; Antisense; TGGAGCATGTTTCCTTATGTTCGCT
>probe:Drosophila_2:1625822_at:332:471; Interrogation_Position=3285; Antisense; GTTCGCTCCGGTTTCAAGATCATTA
>probe:Drosophila_2:1625822_at:589:119; Interrogation_Position=3412; Antisense; GAGGTAGCGGGATGTCGACTTTTTT
>probe:Drosophila_2:1625822_at:604:601; Interrogation_Position=3437; Antisense; TGTATGGCCAGGATCGCGGTGTCAA
>probe:Drosophila_2:1625822_at:545:329; Interrogation_Position=3452; Antisense; GCGGTGTCAAGGCTAAGTCTCTATT
>probe:Drosophila_2:1625822_at:393:79; Interrogation_Position=3504; Antisense; AGGTGTGGCCGATTTGCTTGTAACA
>probe:Drosophila_2:1625822_at:306:117; Interrogation_Position=3538; Antisense; AGCTATCTGGCCATCGACTATGAGG
>probe:Drosophila_2:1625822_at:277:437; Interrogation_Position=3559; Antisense; GAGGCAATGGCTTCGCTGACCAAAA

Paste this into a BLAST search page for me
GAACTTTGGCTTACAGATCGTATGAATTCTATTGTTCTATCCGTGTTCCTGTGTTCCTATCCACCAAATCAGATTGCATTTGTGTAATCGCCTTGTTGGCAAATGCCCAACGAGATTGTCCCGATGATTGTCCCGATACCACAAGTTGTATGGAGCATGTTTCCTTATGTTCGCTGTTCGCTCCGGTTTCAAGATCATTAGAGGTAGCGGGATGTCGACTTTTTTTGTATGGCCAGGATCGCGGTGTCAAGCGGTGTCAAGGCTAAGTCTCTATTAGGTGTGGCCGATTTGCTTGTAACAAGCTATCTGGCCATCGACTATGAGGGAGGCAATGGCTTCGCTGACCAAAA

Full Affymetrix probeset data:

Annotations for 1625822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720