FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625823_at:

>probe:Drosophila_2:1625823_at:84:381; Interrogation_Position=243; Antisense; GAACCAGCTATATATCGCCAGCGCA
>probe:Drosophila_2:1625823_at:290:393; Interrogation_Position=285; Antisense; GAAAGTTGGTGACCTTTCGCCCAAG
>probe:Drosophila_2:1625823_at:726:725; Interrogation_Position=313; Antisense; TTGGTGGACTGCTTTCCCTATCCAA
>probe:Drosophila_2:1625823_at:613:511; Interrogation_Position=361; Antisense; GTGAGTGTGGCCTTTAACTTCAAGA
>probe:Drosophila_2:1625823_at:454:67; Interrogation_Position=392; Antisense; ATGGCATTGCCTCCAAAGAGTCCTA
>probe:Drosophila_2:1625823_at:119:433; Interrogation_Position=439; Antisense; GAGTGTCGCTGGGACCGCAGAAAAA
>probe:Drosophila_2:1625823_at:326:565; Interrogation_Position=469; Antisense; GGCACCTTGCGGGAATACGTTACAC
>probe:Drosophila_2:1625823_at:455:667; Interrogation_Position=589; Antisense; TACTTTGGTGGCATCTTGAGGACTC
>probe:Drosophila_2:1625823_at:503:721; Interrogation_Position=604; Antisense; TTGAGGACTCCTTCGTGTAGAAATA
>probe:Drosophila_2:1625823_at:225:175; Interrogation_Position=643; Antisense; AAACACTCTGTTCTTTTAGTTGGCT
>probe:Drosophila_2:1625823_at:258:467; Interrogation_Position=661; Antisense; GTTGGCTTTGAAACACATCCGAAAT
>probe:Drosophila_2:1625823_at:159:207; Interrogation_Position=735; Antisense; AAGCGGCTACTTTAAGCTGGCTCGA
>probe:Drosophila_2:1625823_at:584:719; Interrogation_Position=794; Antisense; TTGCGAAACTGGTATTGCCCTGTCT
>probe:Drosophila_2:1625823_at:682:625; Interrogation_Position=809; Antisense; TGCCCTGTCTTACCGAAGCTTTAAA

Paste this into a BLAST search page for me
GAACCAGCTATATATCGCCAGCGCAGAAAGTTGGTGACCTTTCGCCCAAGTTGGTGGACTGCTTTCCCTATCCAAGTGAGTGTGGCCTTTAACTTCAAGAATGGCATTGCCTCCAAAGAGTCCTAGAGTGTCGCTGGGACCGCAGAAAAAGGCACCTTGCGGGAATACGTTACACTACTTTGGTGGCATCTTGAGGACTCTTGAGGACTCCTTCGTGTAGAAATAAAACACTCTGTTCTTTTAGTTGGCTGTTGGCTTTGAAACACATCCGAAATAAGCGGCTACTTTAAGCTGGCTCGATTGCGAAACTGGTATTGCCCTGTCTTGCCCTGTCTTACCGAAGCTTTAAA

Full Affymetrix probeset data:

Annotations for 1625823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720