FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625824_at:

>probe:Drosophila_2:1625824_at:132:43; Interrogation_Position=1060; Antisense; ATCGATATTTACTGTGGCATGTCCC
>probe:Drosophila_2:1625824_at:433:143; Interrogation_Position=1070; Antisense; ACTGTGGCATGTCCCATTTTACAAT
>probe:Drosophila_2:1625824_at:669:353; Interrogation_Position=1103; Antisense; GCACGATTTACGATCAATCCCTAAG
>probe:Drosophila_2:1625824_at:345:615; Interrogation_Position=530; Antisense; TGAAGGCCGGCATTATTGAGGAGAT
>probe:Drosophila_2:1625824_at:442:425; Interrogation_Position=550; Antisense; GAGATGCTAGACGAGACCATGGACT
>probe:Drosophila_2:1625824_at:473:629; Interrogation_Position=675; Antisense; TCCAGAGGCTACACCGGCGGACAAG
>probe:Drosophila_2:1625824_at:230:397; Interrogation_Position=694; Antisense; GACAAGGCGTCTGCGTCTGCTGCGC
>probe:Drosophila_2:1625824_at:666:359; Interrogation_Position=759; Antisense; GCAAGAGATGCAAAGCCGCCTGGCC
>probe:Drosophila_2:1625824_at:251:317; Interrogation_Position=781; Antisense; GCCTCGCTGCGATCTTAAAACAACT
>probe:Drosophila_2:1625824_at:607:361; Interrogation_Position=840; Antisense; GCAAGTGATTTTGACTGGCAGACCT
>probe:Drosophila_2:1625824_at:42:407; Interrogation_Position=852; Antisense; GACTGGCAGACCTTATCAAAATCAT
>probe:Drosophila_2:1625824_at:184:601; Interrogation_Position=959; Antisense; TGTACAGTACACCAGATCAAGAAGT
>probe:Drosophila_2:1625824_at:106:83; Interrogation_Position=981; Antisense; AGTGTTGAACTCTGCGCGTTTTACC
>probe:Drosophila_2:1625824_at:604:321; Interrogation_Position=994; Antisense; GCGCGTTTTACCGTTGAATCTACAC

Paste this into a BLAST search page for me
ATCGATATTTACTGTGGCATGTCCCACTGTGGCATGTCCCATTTTACAATGCACGATTTACGATCAATCCCTAAGTGAAGGCCGGCATTATTGAGGAGATGAGATGCTAGACGAGACCATGGACTTCCAGAGGCTACACCGGCGGACAAGGACAAGGCGTCTGCGTCTGCTGCGCGCAAGAGATGCAAAGCCGCCTGGCCGCCTCGCTGCGATCTTAAAACAACTGCAAGTGATTTTGACTGGCAGACCTGACTGGCAGACCTTATCAAAATCATTGTACAGTACACCAGATCAAGAAGTAGTGTTGAACTCTGCGCGTTTTACCGCGCGTTTTACCGTTGAATCTACAC

Full Affymetrix probeset data:

Annotations for 1625824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720