FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625825_at:

>probe:Drosophila_2:1625825_at:125:125; Interrogation_Position=1017; Antisense; AGCCCCATCTTCTGGGTTAGGACAC
>probe:Drosophila_2:1625825_at:485:539; Interrogation_Position=1031; Antisense; GGTTAGGACACAGCCCATTTTCCAT
>probe:Drosophila_2:1625825_at:561:273; Interrogation_Position=1046; Antisense; CATTTTCCATATCCACTTCTGTAGT
>probe:Drosophila_2:1625825_at:567:539; Interrogation_Position=1079; Antisense; GGTAGTTACTACTTGCTTCCTTAAT
>probe:Drosophila_2:1625825_at:67:655; Interrogation_Position=1128; Antisense; TAATTGTGTAAATGCTCGCTATTCA
>probe:Drosophila_2:1625825_at:106:153; Interrogation_Position=594; Antisense; ACATCGACTACTACGGCGCTTGCCA
>probe:Drosophila_2:1625825_at:354:51; Interrogation_Position=668; Antisense; ATGCGCGACTGGCTGTTCAACGTGA
>probe:Drosophila_2:1625825_at:171:603; Interrogation_Position=681; Antisense; TGTTCAACGTGATGCGCGACCTGGC
>probe:Drosophila_2:1625825_at:638:417; Interrogation_Position=716; Antisense; GAGCTGACCGAGCACTACATGCAGA
>probe:Drosophila_2:1625825_at:450:439; Interrogation_Position=749; Antisense; GAGGCGGAGACCAACAACTCGCGTC
>probe:Drosophila_2:1625825_at:408:537; Interrogation_Position=871; Antisense; GGTCAGTCTCGAGCACTGCATCGCA
>probe:Drosophila_2:1625825_at:681:73; Interrogation_Position=924; Antisense; AGGACCATCGCATCACCCTGGTGGA
>probe:Drosophila_2:1625825_at:112:417; Interrogation_Position=965; Antisense; GAGCTGGATCCCGAGGACCTCAAGG
>probe:Drosophila_2:1625825_at:508:555; Interrogation_Position=979; Antisense; GGACCTCAAGGAGCGTTGCGACGAC

Paste this into a BLAST search page for me
AGCCCCATCTTCTGGGTTAGGACACGGTTAGGACACAGCCCATTTTCCATCATTTTCCATATCCACTTCTGTAGTGGTAGTTACTACTTGCTTCCTTAATTAATTGTGTAAATGCTCGCTATTCAACATCGACTACTACGGCGCTTGCCAATGCGCGACTGGCTGTTCAACGTGATGTTCAACGTGATGCGCGACCTGGCGAGCTGACCGAGCACTACATGCAGAGAGGCGGAGACCAACAACTCGCGTCGGTCAGTCTCGAGCACTGCATCGCAAGGACCATCGCATCACCCTGGTGGAGAGCTGGATCCCGAGGACCTCAAGGGGACCTCAAGGAGCGTTGCGACGAC

Full Affymetrix probeset data:

Annotations for 1625825_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720