FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625826_at:

>probe:Drosophila_2:1625826_at:397:243; Interrogation_Position=1073; Antisense; AATTTCGTCCACTTTGTGTTGCCAA
>probe:Drosophila_2:1625826_at:340:449; Interrogation_Position=625; Antisense; GATCGTCAACATGGTTCAGCTGGCC
>probe:Drosophila_2:1625826_at:263:333; Interrogation_Position=643; Antisense; GCTGGCCTCGTACTCGCAGTTAAAG
>probe:Drosophila_2:1625826_at:568:351; Interrogation_Position=668; Antisense; GCAGCATTTTCGGAATACTTTTCGG
>probe:Drosophila_2:1625826_at:658:665; Interrogation_Position=683; Antisense; TACTTTTCGGGACTTTCGCTTCACA
>probe:Drosophila_2:1625826_at:44:607; Interrogation_Position=720; Antisense; TGATGTCCGGTCTATTGACCACCAT
>probe:Drosophila_2:1625826_at:153:347; Interrogation_Position=777; Antisense; GCATCCAGCAGCAAAAGACGGCCGA
>probe:Drosophila_2:1625826_at:283:105; Interrogation_Position=792; Antisense; AGACGGCCGAGTACAAGGGCACCAT
>probe:Drosophila_2:1625826_at:63:83; Interrogation_Position=807; Antisense; AGGGCACCATGGATGTCCTGATGAA
>probe:Drosophila_2:1625826_at:473:209; Interrogation_Position=839; Antisense; AAGAATGAGGGTATCGCCTCCCTGT
>probe:Drosophila_2:1625826_at:616:19; Interrogation_Position=882; Antisense; ATTTGTGTCGCTTAGGACCGCACAC
>probe:Drosophila_2:1625826_at:469:533; Interrogation_Position=907; Antisense; GGTGTTTGCCTTTATATTCCTGGAA
>probe:Drosophila_2:1625826_at:433:561; Interrogation_Position=928; Antisense; GGAACAACTCACCAAGGCCTACAAG
>probe:Drosophila_2:1625826_at:310:5; Interrogation_Position=956; Antisense; ATTGTGCTCGGCGACGATTCTGAAT

Paste this into a BLAST search page for me
AATTTCGTCCACTTTGTGTTGCCAAGATCGTCAACATGGTTCAGCTGGCCGCTGGCCTCGTACTCGCAGTTAAAGGCAGCATTTTCGGAATACTTTTCGGTACTTTTCGGGACTTTCGCTTCACATGATGTCCGGTCTATTGACCACCATGCATCCAGCAGCAAAAGACGGCCGAAGACGGCCGAGTACAAGGGCACCATAGGGCACCATGGATGTCCTGATGAAAAGAATGAGGGTATCGCCTCCCTGTATTTGTGTCGCTTAGGACCGCACACGGTGTTTGCCTTTATATTCCTGGAAGGAACAACTCACCAAGGCCTACAAGATTGTGCTCGGCGACGATTCTGAAT

Full Affymetrix probeset data:

Annotations for 1625826_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720