FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625828_at:

>probe:Drosophila_2:1625828_at:294:239; Interrogation_Position=1000; Antisense; AATCTCTTACACTTGAGACCCTGGG
>probe:Drosophila_2:1625828_at:120:105; Interrogation_Position=1015; Antisense; AGACCCTGGGCTGGGTTCTGAGAAA
>probe:Drosophila_2:1625828_at:18:603; Interrogation_Position=1067; Antisense; TGATTGTAAATCCACCACCGACTAT
>probe:Drosophila_2:1625828_at:484:163; Interrogation_Position=1094; Antisense; AAATTTGCATCTGGGTTTGCTAAGC
>probe:Drosophila_2:1625828_at:486:241; Interrogation_Position=550; Antisense; AATAGGTACAAGCATCCTGCCTGCC
>probe:Drosophila_2:1625828_at:285:725; Interrogation_Position=664; Antisense; TTGAAGGTGCAGCTCCAGGGCTATA
>probe:Drosophila_2:1625828_at:12:547; Interrogation_Position=711; Antisense; GGATGCGAATGATGAGTTGCCCAAT
>probe:Drosophila_2:1625828_at:249:213; Interrogation_Position=748; Antisense; AAGAGCCAGCTGTGCATCGGATCAA
>probe:Drosophila_2:1625828_at:375:225; Interrogation_Position=781; Antisense; AAGGACACATGCAACGGCGACTCTG
>probe:Drosophila_2:1625828_at:709:629; Interrogation_Position=810; Antisense; TCCAGTGCTGGCCTATCACAAGGAT
>probe:Drosophila_2:1625828_at:315:635; Interrogation_Position=836; Antisense; TCGCCTGCATGTACCACGTAATGGG
>probe:Drosophila_2:1625828_at:295:657; Interrogation_Position=854; Antisense; TAATGGGCATCACCTCAGCCGGCAT
>probe:Drosophila_2:1625828_at:62:403; Interrogation_Position=895; Antisense; GACATTCCAAGTGCCTACACGCGGG
>probe:Drosophila_2:1625828_at:366:617; Interrogation_Position=920; Antisense; TGCACTACTTCCTCAACTGGATCAA

Paste this into a BLAST search page for me
AATCTCTTACACTTGAGACCCTGGGAGACCCTGGGCTGGGTTCTGAGAAATGATTGTAAATCCACCACCGACTATAAATTTGCATCTGGGTTTGCTAAGCAATAGGTACAAGCATCCTGCCTGCCTTGAAGGTGCAGCTCCAGGGCTATAGGATGCGAATGATGAGTTGCCCAATAAGAGCCAGCTGTGCATCGGATCAAAAGGACACATGCAACGGCGACTCTGTCCAGTGCTGGCCTATCACAAGGATTCGCCTGCATGTACCACGTAATGGGTAATGGGCATCACCTCAGCCGGCATGACATTCCAAGTGCCTACACGCGGGTGCACTACTTCCTCAACTGGATCAA

Full Affymetrix probeset data:

Annotations for 1625828_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720