Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625829_a_at:

>probe:Drosophila_2:1625829_a_at:128:469; Interrogation_Position=126; Antisense; GTTCTACAACCCCAAGAAATCCAAG
>probe:Drosophila_2:1625829_a_at:40:67; Interrogation_Position=13; Antisense; ATGGACTCGGATTCACTACAGGAAC
>probe:Drosophila_2:1625829_a_at:46:201; Interrogation_Position=133; Antisense; AACCCCAAGAAATCCAAGTGTCAAG
>probe:Drosophila_2:1625829_a_at:599:219; Interrogation_Position=148; Antisense; AAGTGTCAAGTTTTTATCTACTCGA
>probe:Drosophila_2:1625829_a_at:337:705; Interrogation_Position=161; Antisense; TTATCTACTCGAATTGTGGTGGCAA
>probe:Drosophila_2:1625829_a_at:522:589; Interrogation_Position=177; Antisense; TGGTGGCAATGGCAACCTTTTCTAT
>probe:Drosophila_2:1625829_a_at:96:65; Interrogation_Position=185; Antisense; ATGGCAACCTTTTCTATACCAAGGA
>probe:Drosophila_2:1625829_a_at:362:671; Interrogation_Position=201; Antisense; TACCAAGGAAAGTTGCGTGGAATTT
>probe:Drosophila_2:1625829_a_at:157:463; Interrogation_Position=22; Antisense; GATTCACTACAGGAACAGTACGAAA
>probe:Drosophila_2:1625829_a_at:209:701; Interrogation_Position=223; Antisense; TTTTGTGGCAAATACGACTGGAAGA
>probe:Drosophila_2:1625829_a_at:283:241; Interrogation_Position=233; Antisense; AATACGACTGGAAGAAGGTGCGAAA
>probe:Drosophila_2:1625829_a_at:496:81; Interrogation_Position=46; Antisense; AGGGAGCAGTACAATATTCGCAAAA
>probe:Drosophila_2:1625829_a_at:712:17; Interrogation_Position=73; Antisense; ATTTGCCTTCAAAGTTCGGAATACG
>probe:Drosophila_2:1625829_a_at:421:393; Interrogation_Position=98; Antisense; GAAAGTGCAAAGGTCGTCGGAAACT

Paste this into a BLAST search page for me
GTTCTACAACCCCAAGAAATCCAAGATGGACTCGGATTCACTACAGGAACAACCCCAAGAAATCCAAGTGTCAAGAAGTGTCAAGTTTTTATCTACTCGATTATCTACTCGAATTGTGGTGGCAATGGTGGCAATGGCAACCTTTTCTATATGGCAACCTTTTCTATACCAAGGATACCAAGGAAAGTTGCGTGGAATTTGATTCACTACAGGAACAGTACGAAATTTTGTGGCAAATACGACTGGAAGAAATACGACTGGAAGAAGGTGCGAAAAGGGAGCAGTACAATATTCGCAAAAATTTGCCTTCAAAGTTCGGAATACGGAAAGTGCAAAGGTCGTCGGAAACT

Full Affymetrix probeset data:

Annotations for 1625829_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime