Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625833_at:

>probe:Drosophila_2:1625833_at:460:451; Interrogation_Position=1462; Antisense; GATCGTGCAATACTAGAGTTTCGTT
>probe:Drosophila_2:1625833_at:464:427; Interrogation_Position=1487; Antisense; GAGTTTGTTGAAGTTGTCCAGGCTT
>probe:Drosophila_2:1625833_at:17:505; Interrogation_Position=1502; Antisense; GTCCAGGCTTTAAGTGTAGGCATAT
>probe:Drosophila_2:1625833_at:505:659; Interrogation_Position=1536; Antisense; TAACCCTAAGTTTCACAAATCGTTG
>probe:Drosophila_2:1625833_at:563:701; Interrogation_Position=1561; Antisense; TTAGCTGAAGTTAGAGCGCTCCCCA
>probe:Drosophila_2:1625833_at:663:39; Interrogation_Position=1595; Antisense; ATCTGTTTTCCGTAATACCAGGCAA
>probe:Drosophila_2:1625833_at:502:479; Interrogation_Position=1647; Antisense; GTTTGGAAACGCCTATGTACCTCTT
>probe:Drosophila_2:1625833_at:13:487; Interrogation_Position=1663; Antisense; GTACCTCTTAATAGCAGTATGTTTG
>probe:Drosophila_2:1625833_at:77:603; Interrogation_Position=1682; Antisense; TGTTTGCAAAGTCAGTTTTCGTTAC
>probe:Drosophila_2:1625833_at:116:701; Interrogation_Position=1697; Antisense; TTTTCGTTACTCACACAGCACTAAG
>probe:Drosophila_2:1625833_at:554:261; Interrogation_Position=1712; Antisense; CAGCACTAAGCGCACAAGAAAATAT
>probe:Drosophila_2:1625833_at:629:23; Interrogation_Position=1733; Antisense; ATATCCCGAGCGGATTTGCTCACAT
>probe:Drosophila_2:1625833_at:83:483; Interrogation_Position=1836; Antisense; GTATATTTATTTCCCACACTGTAAA
>probe:Drosophila_2:1625833_at:591:253; Interrogation_Position=1936; Antisense; CAAACACACACACCTACTTACAAAA

Paste this into a BLAST search page for me
GATCGTGCAATACTAGAGTTTCGTTGAGTTTGTTGAAGTTGTCCAGGCTTGTCCAGGCTTTAAGTGTAGGCATATTAACCCTAAGTTTCACAAATCGTTGTTAGCTGAAGTTAGAGCGCTCCCCAATCTGTTTTCCGTAATACCAGGCAAGTTTGGAAACGCCTATGTACCTCTTGTACCTCTTAATAGCAGTATGTTTGTGTTTGCAAAGTCAGTTTTCGTTACTTTTCGTTACTCACACAGCACTAAGCAGCACTAAGCGCACAAGAAAATATATATCCCGAGCGGATTTGCTCACATGTATATTTATTTCCCACACTGTAAACAAACACACACACCTACTTACAAAA

Full Affymetrix probeset data:

Annotations for 1625833_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime