FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625835_at:

>probe:Drosophila_2:1625835_at:314:231; Interrogation_Position=1003; Antisense; AATGAGTTTGTGGTCTCCAACCGGG
>probe:Drosophila_2:1625835_at:594:625; Interrogation_Position=1018; Antisense; TCCAACCGGGTTCTGCAGCAGGAAT
>probe:Drosophila_2:1625835_at:275:201; Interrogation_Position=1045; Antisense; AACGCCGCACGTTCCGATCATGGGA
>probe:Drosophila_2:1625835_at:56:647; Interrogation_Position=1062; Antisense; TCATGGGAACGATTTCCGGGTACTC
>probe:Drosophila_2:1625835_at:210:139; Interrogation_Position=1114; Antisense; ACGATGCACGCTTACGATCCTGGGA
>probe:Drosophila_2:1625835_at:556:585; Interrogation_Position=1186; Antisense; TGGAAGACCAGCAAGCCCATCTCGG
>probe:Drosophila_2:1625835_at:50:643; Interrogation_Position=1205; Antisense; TCTCGGCGGAAAACTATGGCTCTGT
>probe:Drosophila_2:1625835_at:151:67; Interrogation_Position=1220; Antisense; ATGGCTCTGTGGATTCCAATGCCGA
>probe:Drosophila_2:1625835_at:268:17; Interrogation_Position=1252; Antisense; ATTTATCCCAGCGACTTGTCGATTG
>probe:Drosophila_2:1625835_at:423:441; Interrogation_Position=1282; Antisense; GATGGCACCATTTGGGTCATGTCCA
>probe:Drosophila_2:1625835_at:501:209; Interrogation_Position=1369; Antisense; AAGCAGAAGGCTTCACTGGCCAAGA
>probe:Drosophila_2:1625835_at:463:529; Interrogation_Position=884; Antisense; GGGATCTCAGCATTGGCGGCCAGAC
>probe:Drosophila_2:1625835_at:324:409; Interrogation_Position=919; Antisense; GACGATGGCATCTTCTCAATAACTT
>probe:Drosophila_2:1625835_at:409:177; Interrogation_Position=955; Antisense; AAACTGGATGGGAGCCGCGATGCCT

Paste this into a BLAST search page for me
AATGAGTTTGTGGTCTCCAACCGGGTCCAACCGGGTTCTGCAGCAGGAATAACGCCGCACGTTCCGATCATGGGATCATGGGAACGATTTCCGGGTACTCACGATGCACGCTTACGATCCTGGGATGGAAGACCAGCAAGCCCATCTCGGTCTCGGCGGAAAACTATGGCTCTGTATGGCTCTGTGGATTCCAATGCCGAATTTATCCCAGCGACTTGTCGATTGGATGGCACCATTTGGGTCATGTCCAAAGCAGAAGGCTTCACTGGCCAAGAGGGATCTCAGCATTGGCGGCCAGACGACGATGGCATCTTCTCAATAACTTAAACTGGATGGGAGCCGCGATGCCT

Full Affymetrix probeset data:

Annotations for 1625835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720