Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625836_at:

>probe:Drosophila_2:1625836_at:260:565; Interrogation_Position=432; Antisense; GGAATATGTGCAACGGCGCTTCGAA
>probe:Drosophila_2:1625836_at:230:521; Interrogation_Position=473; Antisense; GTGGCTTTCAGACCATCGAACAGTG
>probe:Drosophila_2:1625836_at:465:385; Interrogation_Position=490; Antisense; GAACAGTGCTCCCTGGAGTACGAGC
>probe:Drosophila_2:1625836_at:662:425; Interrogation_Position=505; Antisense; GAGTACGAGCCCAGCAAAGGAGCCA
>probe:Drosophila_2:1625836_at:389:225; Interrogation_Position=521; Antisense; AAGGAGCCAGCATAGATCCGCACGT
>probe:Drosophila_2:1625836_at:353:449; Interrogation_Position=535; Antisense; GATCCGCACGTGGACGATTGCTGGA
>probe:Drosophila_2:1625836_at:663:415; Interrogation_Position=568; Antisense; GAGCGTGTGGTCACTGTCAACTGCC
>probe:Drosophila_2:1625836_at:384:681; Interrogation_Position=747; Antisense; TATGCCAAACCTCTCCTTGATAGTT
>probe:Drosophila_2:1625836_at:602:483; Interrogation_Position=774; Antisense; GTATGGGCCAGCGAGGTACCAGTTT
>probe:Drosophila_2:1625836_at:125:481; Interrogation_Position=795; Antisense; GTTTGAGCATTCTGTACTACGCGAG
>probe:Drosophila_2:1625836_at:641:435; Interrogation_Position=817; Antisense; GAGGATGTCCAAGAGCGCCGCGTTT
>probe:Drosophila_2:1625836_at:231:691; Interrogation_Position=840; Antisense; TTGTGTAGCCTACCGGGAGTTTACG
>probe:Drosophila_2:1625836_at:237:551; Interrogation_Position=855; Antisense; GGAGTTTACGCCCATGTACATCAAT
>probe:Drosophila_2:1625836_at:363:527; Interrogation_Position=897; Antisense; GGGAGATCCTGTCCGAGAAAAGTCT

Paste this into a BLAST search page for me
GGAATATGTGCAACGGCGCTTCGAAGTGGCTTTCAGACCATCGAACAGTGGAACAGTGCTCCCTGGAGTACGAGCGAGTACGAGCCCAGCAAAGGAGCCAAAGGAGCCAGCATAGATCCGCACGTGATCCGCACGTGGACGATTGCTGGAGAGCGTGTGGTCACTGTCAACTGCCTATGCCAAACCTCTCCTTGATAGTTGTATGGGCCAGCGAGGTACCAGTTTGTTTGAGCATTCTGTACTACGCGAGGAGGATGTCCAAGAGCGCCGCGTTTTTGTGTAGCCTACCGGGAGTTTACGGGAGTTTACGCCCATGTACATCAATGGGAGATCCTGTCCGAGAAAAGTCT

Full Affymetrix probeset data:

Annotations for 1625836_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime