FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625837_at:

>probe:Drosophila_2:1625837_at:479:1; Interrogation_Position=119; Antisense; AGAATTTTCCACAGGGAGTCCACCT
>probe:Drosophila_2:1625837_at:166:687; Interrogation_Position=211; Antisense; TATTCCCGAAATCCCGAAGGACTGT
>probe:Drosophila_2:1625837_at:341:59; Interrogation_Position=270; Antisense; ATGTTCAGGCTCCAAAACCGTGTGT
>probe:Drosophila_2:1625837_at:100:203; Interrogation_Position=285; Antisense; AACCGTGTGTGAAATACTGCCTGCA
>probe:Drosophila_2:1625837_at:728:77; Interrogation_Position=311; Antisense; AGGATCACCTGTCCCAATAACCAGA
>probe:Drosophila_2:1625837_at:537:123; Interrogation_Position=348; Antisense; AGCCCAACCAGTGTGTCGATCTCGA
>probe:Drosophila_2:1625837_at:603:79; Interrogation_Position=381; Antisense; AGGTGCTGGCCGTCCACGAGGCAAA
>probe:Drosophila_2:1625837_at:318:607; Interrogation_Position=450; Antisense; TGATGGTGGCCATGATCGACTTCCC
>probe:Drosophila_2:1625837_at:545:445; Interrogation_Position=49; Antisense; GATGAAGCGGTTTCTTGTGGCCTTA
>probe:Drosophila_2:1625837_at:158:43; Interrogation_Position=501; Antisense; ATCGTGGTCGCTGTCGGGAAATCTG
>probe:Drosophila_2:1625837_at:505:165; Interrogation_Position=519; Antisense; AAATCTGGTGATTCGATGGCTTCGT
>probe:Drosophila_2:1625837_at:177:341; Interrogation_Position=537; Antisense; GCTTCGTGACACGTGTTTACTGCAT
>probe:Drosophila_2:1625837_at:469:477; Interrogation_Position=583; Antisense; GTTTTTATATACATGCCTGCTCCCA
>probe:Drosophila_2:1625837_at:439:627; Interrogation_Position=596; Antisense; TGCCTGCTCCCAATAATCACAATAA

Paste this into a BLAST search page for me
AGAATTTTCCACAGGGAGTCCACCTTATTCCCGAAATCCCGAAGGACTGTATGTTCAGGCTCCAAAACCGTGTGTAACCGTGTGTGAAATACTGCCTGCAAGGATCACCTGTCCCAATAACCAGAAGCCCAACCAGTGTGTCGATCTCGAAGGTGCTGGCCGTCCACGAGGCAAATGATGGTGGCCATGATCGACTTCCCGATGAAGCGGTTTCTTGTGGCCTTAATCGTGGTCGCTGTCGGGAAATCTGAAATCTGGTGATTCGATGGCTTCGTGCTTCGTGACACGTGTTTACTGCATGTTTTTATATACATGCCTGCTCCCATGCCTGCTCCCAATAATCACAATAA

Full Affymetrix probeset data:

Annotations for 1625837_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720