FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625838_at:

>probe:Drosophila_2:1625838_at:372:201; Interrogation_Position=3166; Antisense; AACCACTCGTTCAAGAATTTGTCCT
>probe:Drosophila_2:1625838_at:573:243; Interrogation_Position=3181; Antisense; AATTTGTCCTTATATTCGTGTGTGG
>probe:Drosophila_2:1625838_at:414:291; Interrogation_Position=3197; Antisense; CGTGTGTGGATTTCGCTTTTAGTCA
>probe:Drosophila_2:1625838_at:600:693; Interrogation_Position=3207; Antisense; TTTCGCTTTTAGTCAAGTCCCAACT
>probe:Drosophila_2:1625838_at:493:137; Interrogation_Position=3325; Antisense; ACGTACCCGAGAAACAATTGTTGAT
>probe:Drosophila_2:1625838_at:430:363; Interrogation_Position=3350; Antisense; GAATTCGTGCATAGGCATAACGCAA
>probe:Drosophila_2:1625838_at:290:151; Interrogation_Position=3375; Antisense; ACATTTTTGCGCTACATTGTTGTCA
>probe:Drosophila_2:1625838_at:671:467; Interrogation_Position=3393; Antisense; GTTGTCATTTGAACCAATACTTAGC
>probe:Drosophila_2:1625838_at:265:7; Interrogation_Position=3427; Antisense; ATTGCATTGTGTACTCAGCTAAACC
>probe:Drosophila_2:1625838_at:199:589; Interrogation_Position=3507; Antisense; TGGATTCCATTTAAATTGCAACAGA
>probe:Drosophila_2:1625838_at:4:363; Interrogation_Position=3530; Antisense; GAATAACCCAACTAGGCAATGTATA
>probe:Drosophila_2:1625838_at:13:181; Interrogation_Position=3605; Antisense; AAACACTAACACACATCTGCATACC
>probe:Drosophila_2:1625838_at:188:643; Interrogation_Position=3620; Antisense; TCTGCATACCCGTACTTATGAGGAT
>probe:Drosophila_2:1625838_at:342:539; Interrogation_Position=3695; Antisense; GGTATTGAACTTATTGTATTCCCAT

Paste this into a BLAST search page for me
AACCACTCGTTCAAGAATTTGTCCTAATTTGTCCTTATATTCGTGTGTGGCGTGTGTGGATTTCGCTTTTAGTCATTTCGCTTTTAGTCAAGTCCCAACTACGTACCCGAGAAACAATTGTTGATGAATTCGTGCATAGGCATAACGCAAACATTTTTGCGCTACATTGTTGTCAGTTGTCATTTGAACCAATACTTAGCATTGCATTGTGTACTCAGCTAAACCTGGATTCCATTTAAATTGCAACAGAGAATAACCCAACTAGGCAATGTATAAAACACTAACACACATCTGCATACCTCTGCATACCCGTACTTATGAGGATGGTATTGAACTTATTGTATTCCCAT

Full Affymetrix probeset data:

Annotations for 1625838_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720