FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625839_at:

>probe:Drosophila_2:1625839_at:58:313; Interrogation_Position=1552; Antisense; GCCAAATTCGCGCATCTCAGTGATG
>probe:Drosophila_2:1625839_at:287:441; Interrogation_Position=1573; Antisense; GATGGGCGGAACTCAGGCAGCCAAT
>probe:Drosophila_2:1625839_at:349:231; Interrogation_Position=1595; Antisense; AATGTTATGGCTCAGATCACCGAAG
>probe:Drosophila_2:1625839_at:288:35; Interrogation_Position=1610; Antisense; ATCACCGAAGATCAACGCAAGCGAG
>probe:Drosophila_2:1625839_at:57:173; Interrogation_Position=1666; Antisense; AAAGCTGAAGGCTCCCATTGTGGAA
>probe:Drosophila_2:1625839_at:65:347; Interrogation_Position=1703; Antisense; GAGGGTTCGCCCTACTACAGTACGG
>probe:Drosophila_2:1625839_at:311:153; Interrogation_Position=1719; Antisense; ACAGTACGGCTCGTCTGTGGGACGA
>probe:Drosophila_2:1625839_at:463:517; Interrogation_Position=1737; Antisense; GGGACGACGGCATCATTGATCCGGC
>probe:Drosophila_2:1625839_at:394:449; Interrogation_Position=1774; Antisense; GATCCTGGGCCTTAGCTTGAAAGCA
>probe:Drosophila_2:1625839_at:567:173; Interrogation_Position=1793; Antisense; AAAGCAGCCTTGAACAACGCCGGTC
>probe:Drosophila_2:1625839_at:477:413; Interrogation_Position=1822; Antisense; GACCAAGTTTGGAGTCTTCCGCATG
>probe:Drosophila_2:1625839_at:101:431; Interrogation_Position=1833; Antisense; GAGTCTTCCGCATGTAAATCCAATT
>probe:Drosophila_2:1625839_at:613:237; Interrogation_Position=1876; Antisense; AATCGGAGCGCATTTACAGGCATTT
>probe:Drosophila_2:1625839_at:620:233; Interrogation_Position=1901; Antisense; AATGCCTTTATTTCGAAACTGTTGC

Paste this into a BLAST search page for me
GCCAAATTCGCGCATCTCAGTGATGGATGGGCGGAACTCAGGCAGCCAATAATGTTATGGCTCAGATCACCGAAGATCACCGAAGATCAACGCAAGCGAGAAAGCTGAAGGCTCCCATTGTGGAAGAGGGTTCGCCCTACTACAGTACGGACAGTACGGCTCGTCTGTGGGACGAGGGACGACGGCATCATTGATCCGGCGATCCTGGGCCTTAGCTTGAAAGCAAAAGCAGCCTTGAACAACGCCGGTCGACCAAGTTTGGAGTCTTCCGCATGGAGTCTTCCGCATGTAAATCCAATTAATCGGAGCGCATTTACAGGCATTTAATGCCTTTATTTCGAAACTGTTGC

Full Affymetrix probeset data:

Annotations for 1625839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720