Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625840_at:

>probe:Drosophila_2:1625840_at:720:421; Interrogation_Position=1516; Antisense; GAGCAAGGCTCTAAACTGCTGCAGA
>probe:Drosophila_2:1625840_at:16:83; Interrogation_Position=1541; Antisense; AGGGATTTGGCTACGACACCAGCGA
>probe:Drosophila_2:1625840_at:595:155; Interrogation_Position=1556; Antisense; ACACCAGCGAGGCTAATAGCACCAT
>probe:Drosophila_2:1625840_at:339:433; Interrogation_Position=1619; Antisense; GAGTGAGCACCGTATTCGATGGCCT
>probe:Drosophila_2:1625840_at:20:483; Interrogation_Position=1630; Antisense; GTATTCGATGGCCTCGAGACTTCCG
>probe:Drosophila_2:1625840_at:472:213; Interrogation_Position=1657; Antisense; AAGATCCTAGGCTCCAGCCTCAGTG
>probe:Drosophila_2:1625840_at:66:261; Interrogation_Position=1671; Antisense; CAGCCTCAGTGAAAACTCCGTCAAG
>probe:Drosophila_2:1625840_at:471:525; Interrogation_Position=1726; Antisense; GGGAATCTGGCTAGTGGCACCTTTG
>probe:Drosophila_2:1625840_at:583:519; Interrogation_Position=1739; Antisense; GTGGCACCTTTGACACGGTGGGCAA
>probe:Drosophila_2:1625840_at:729:563; Interrogation_Position=1759; Antisense; GGCAACGTTTTCGTGGTCAGTCAGA
>probe:Drosophila_2:1625840_at:415:381; Interrogation_Position=1782; Antisense; GAACGTGAACTACATAACCCCGAAG
>probe:Drosophila_2:1625840_at:57:591; Interrogation_Position=1847; Antisense; TGGTCAGTGACTACAAGCGAGACTT
>probe:Drosophila_2:1625840_at:113:403; Interrogation_Position=1867; Antisense; GACTTACGCAAATCGGAATCTCATT
>probe:Drosophila_2:1625840_at:250:699; Interrogation_Position=1910; Antisense; TTTATCCGGATCTTCGAGCTTTGAA

Paste this into a BLAST search page for me
GAGCAAGGCTCTAAACTGCTGCAGAAGGGATTTGGCTACGACACCAGCGAACACCAGCGAGGCTAATAGCACCATGAGTGAGCACCGTATTCGATGGCCTGTATTCGATGGCCTCGAGACTTCCGAAGATCCTAGGCTCCAGCCTCAGTGCAGCCTCAGTGAAAACTCCGTCAAGGGGAATCTGGCTAGTGGCACCTTTGGTGGCACCTTTGACACGGTGGGCAAGGCAACGTTTTCGTGGTCAGTCAGAGAACGTGAACTACATAACCCCGAAGTGGTCAGTGACTACAAGCGAGACTTGACTTACGCAAATCGGAATCTCATTTTTATCCGGATCTTCGAGCTTTGAA

Full Affymetrix probeset data:

Annotations for 1625840_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime