FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625841_at:

>probe:Drosophila_2:1625841_at:134:31; Interrogation_Position=161; Antisense; ATAAACCCTATTTCATCCTGGATGT
>probe:Drosophila_2:1625841_at:342:517; Interrogation_Position=184; Antisense; GTGGGCTGCAATTGCGGCGTACTCA
>probe:Drosophila_2:1625841_at:658:291; Interrogation_Position=201; Antisense; CGTACTCACTCAACTCATGCATAAA
>probe:Drosophila_2:1625841_at:673:437; Interrogation_Position=232; Antisense; GAGGAACGTCTTCATAGATCTGTGA
>probe:Drosophila_2:1625841_at:72:543; Interrogation_Position=270; Antisense; GGATATAGACCCTCGGCTGATTCAA
>probe:Drosophila_2:1625841_at:329:171; Interrogation_Position=322; Antisense; AAAGATGTGAGCTACGCCTGCGTGG
>probe:Drosophila_2:1625841_at:471:243; Interrogation_Position=410; Antisense; AATTTGATGCCATTTGCTGCTACTC
>probe:Drosophila_2:1625841_at:221:335; Interrogation_Position=425; Antisense; GCTGCTACTCCATTACCATGTGGAT
>probe:Drosophila_2:1625841_at:343:227; Interrogation_Position=470; Antisense; AAGGCCTGCGATTCTTTCTGCAAAA
>probe:Drosophila_2:1625841_at:532:693; Interrogation_Position=484; Antisense; TTTCTGCAAAAGCTCTCCAATCTGG
>probe:Drosophila_2:1625841_at:66:251; Interrogation_Position=501; Antisense; CAATCTGGCAGAGCTCCTGGTGGTG
>probe:Drosophila_2:1625841_at:649:377; Interrogation_Position=526; Antisense; GAACCACAGCCCTGGAAATGCTATC
>probe:Drosophila_2:1625841_at:21:99; Interrogation_Position=582; Antisense; AGAGATATTCCCTCTTTTCCTGGAA
>probe:Drosophila_2:1625841_at:662:693; Interrogation_Position=597; Antisense; TTTCCTGGAACTTAAGTGGCGATCT

Paste this into a BLAST search page for me
ATAAACCCTATTTCATCCTGGATGTGTGGGCTGCAATTGCGGCGTACTCACGTACTCACTCAACTCATGCATAAAGAGGAACGTCTTCATAGATCTGTGAGGATATAGACCCTCGGCTGATTCAAAAAGATGTGAGCTACGCCTGCGTGGAATTTGATGCCATTTGCTGCTACTCGCTGCTACTCCATTACCATGTGGATAAGGCCTGCGATTCTTTCTGCAAAATTTCTGCAAAAGCTCTCCAATCTGGCAATCTGGCAGAGCTCCTGGTGGTGGAACCACAGCCCTGGAAATGCTATCAGAGATATTCCCTCTTTTCCTGGAATTTCCTGGAACTTAAGTGGCGATCT

Full Affymetrix probeset data:

Annotations for 1625841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720