FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625846_at:

>probe:Drosophila_2:1625846_at:497:719; Interrogation_Position=261; Antisense; TTGCCTGCGGAGATCTTTTATTCAC
>probe:Drosophila_2:1625846_at:332:703; Interrogation_Position=278; Antisense; TTATTCACGATCTTCTTCACCGAAA
>probe:Drosophila_2:1625846_at:357:699; Interrogation_Position=358; Antisense; TTCTGTGTGCCGTGGAAAACCTGGT
>probe:Drosophila_2:1625846_at:423:403; Interrogation_Position=400; Antisense; GACTTTCTGCAGCATCTTAGGTGCC
>probe:Drosophila_2:1625846_at:709:679; Interrogation_Position=417; Antisense; TAGGTGCCGTTGGATCACTGTGCAT
>probe:Drosophila_2:1625846_at:516:597; Interrogation_Position=435; Antisense; TGTGCATTGTGCTCGAGGTGTTGAC
>probe:Drosophila_2:1625846_at:591:557; Interrogation_Position=485; Antisense; GGACAGAACAGTGCCGGCTTGCTTA
>probe:Drosophila_2:1625846_at:472:133; Interrogation_Position=519; Antisense; ACGCCGGACCAGTGTTCAAATTCAT
>probe:Drosophila_2:1625846_at:317:577; Interrogation_Position=569; Antisense; GGCGCCATATACTTTTTCCAATTGA
>probe:Drosophila_2:1625846_at:715:559; Interrogation_Position=601; Antisense; GGAACGTATTCTATCAGTCCACGCC
>probe:Drosophila_2:1625846_at:95:717; Interrogation_Position=626; Antisense; TTCGAGGCTCAATTGCGCTACAAGA
>probe:Drosophila_2:1625846_at:339:139; Interrogation_Position=660; Antisense; ACGTACAACCTGGTGAACCTGCTGT
>probe:Drosophila_2:1625846_at:117:201; Interrogation_Position=675; Antisense; AACCTGCTGTCCAGGATTCCGGGAA
>probe:Drosophila_2:1625846_at:527:503; Interrogation_Position=740; Antisense; GTCCACGAGTTGTCCCCGTAAATTG

Paste this into a BLAST search page for me
TTGCCTGCGGAGATCTTTTATTCACTTATTCACGATCTTCTTCACCGAAATTCTGTGTGCCGTGGAAAACCTGGTGACTTTCTGCAGCATCTTAGGTGCCTAGGTGCCGTTGGATCACTGTGCATTGTGCATTGTGCTCGAGGTGTTGACGGACAGAACAGTGCCGGCTTGCTTAACGCCGGACCAGTGTTCAAATTCATGGCGCCATATACTTTTTCCAATTGAGGAACGTATTCTATCAGTCCACGCCTTCGAGGCTCAATTGCGCTACAAGAACGTACAACCTGGTGAACCTGCTGTAACCTGCTGTCCAGGATTCCGGGAAGTCCACGAGTTGTCCCCGTAAATTG

Full Affymetrix probeset data:

Annotations for 1625846_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720