FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625847_at:

>probe:Drosophila_2:1625847_at:337:439; Interrogation_Position=120; Antisense; GAGGCTCCACATCGCTGCTGAAGCG
>probe:Drosophila_2:1625847_at:614:283; Interrogation_Position=137; Antisense; CTGAAGCGCGCCTGGAACGAGATTC
>probe:Drosophila_2:1625847_at:77:429; Interrogation_Position=155; Antisense; GAGATTCCGGACATCGTCGGCGGAT
>probe:Drosophila_2:1625847_at:495:673; Interrogation_Position=18; Antisense; TAGCCAGCAGGCCAGCTCTAATCAG
>probe:Drosophila_2:1625847_at:426:287; Interrogation_Position=196; Antisense; CGGAATCGTTATGGCCACCATCGGA
>probe:Drosophila_2:1625847_at:553:433; Interrogation_Position=219; Antisense; GAGTGGCCAACTACTATGCCAAGGA
>probe:Drosophila_2:1625847_at:717:73; Interrogation_Position=240; Antisense; AGGACGGCGATAACCGACGCTACAA
>probe:Drosophila_2:1625847_at:216:409; Interrogation_Position=255; Antisense; GACGCTACAAGCTCGGCTACGTTGT
>probe:Drosophila_2:1625847_at:401:437; Interrogation_Position=326; Antisense; GATGACTAGAGGAGTTGGACCCTTC
>probe:Drosophila_2:1625847_at:478:585; Interrogation_Position=341; Antisense; TGGACCCTTCGGAAAAATCCTGTCG
>probe:Drosophila_2:1625847_at:548:47; Interrogation_Position=357; Antisense; ATCCTGTCGGCTTTCATCTTTGATT
>probe:Drosophila_2:1625847_at:153:237; Interrogation_Position=37; Antisense; AATCAGCTGTTTGGTTTGTTCGTTG
>probe:Drosophila_2:1625847_at:431:381; Interrogation_Position=74; Antisense; GAACGCGTTGAATTTTTGTGTACCA
>probe:Drosophila_2:1625847_at:210:693; Interrogation_Position=88; Antisense; TTTGTGTACCAAGATGTCCGCATCC

Paste this into a BLAST search page for me
GAGGCTCCACATCGCTGCTGAAGCGCTGAAGCGCGCCTGGAACGAGATTCGAGATTCCGGACATCGTCGGCGGATTAGCCAGCAGGCCAGCTCTAATCAGCGGAATCGTTATGGCCACCATCGGAGAGTGGCCAACTACTATGCCAAGGAAGGACGGCGATAACCGACGCTACAAGACGCTACAAGCTCGGCTACGTTGTGATGACTAGAGGAGTTGGACCCTTCTGGACCCTTCGGAAAAATCCTGTCGATCCTGTCGGCTTTCATCTTTGATTAATCAGCTGTTTGGTTTGTTCGTTGGAACGCGTTGAATTTTTGTGTACCATTTGTGTACCAAGATGTCCGCATCC

Full Affymetrix probeset data:

Annotations for 1625847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720