Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625849_at:

>probe:Drosophila_2:1625849_at:444:239; Interrogation_Position=1005; Antisense; AATCAGCCCGTAGAGCGGACGGTCA
>probe:Drosophila_2:1625849_at:349:557; Interrogation_Position=1021; Antisense; GGACGGTCAGCAATTCTTGTCGCTA
>probe:Drosophila_2:1625849_at:375:487; Interrogation_Position=1125; Antisense; GTAGCCTAACTACCATCAACTATTA
>probe:Drosophila_2:1625849_at:38:657; Interrogation_Position=1148; Antisense; TAATCCATTTGTACTACGTCTAGAA
>probe:Drosophila_2:1625849_at:512:201; Interrogation_Position=1204; Antisense; AACCGATGCTGTATAGATTCCACTA
>probe:Drosophila_2:1625849_at:540:363; Interrogation_Position=1252; Antisense; GAATAGGCGAGCTCCATTGACACAT
>probe:Drosophila_2:1625849_at:643:397; Interrogation_Position=1270; Antisense; GACACATTTTTTCAACATTTCCTAA
>probe:Drosophila_2:1625849_at:670:521; Interrogation_Position=1311; Antisense; GGGCGCCCCTCATACGGAAAATGTC
>probe:Drosophila_2:1625849_at:713:37; Interrogation_Position=1358; Antisense; ATCTTTATAAGTAATTCGCTCCGAA
>probe:Drosophila_2:1625849_at:699:107; Interrogation_Position=802; Antisense; AGAAGGAGTACCTCAGCTTGTGGCT
>probe:Drosophila_2:1625849_at:63:333; Interrogation_Position=824; Antisense; GCTGGTCGTTTGTGAGGTCCGCAAT
>probe:Drosophila_2:1625849_at:57:377; Interrogation_Position=890; Antisense; GAAGCTAAAGAAGCCGCGCTCCTCA
>probe:Drosophila_2:1625849_at:202:677; Interrogation_Position=938; Antisense; TAGGTATTTCCGAAGCCCGAGCCTC
>probe:Drosophila_2:1625849_at:134:631; Interrogation_Position=975; Antisense; TCCTTTCCATCATCTTACTTTTCAA

Paste this into a BLAST search page for me
AATCAGCCCGTAGAGCGGACGGTCAGGACGGTCAGCAATTCTTGTCGCTAGTAGCCTAACTACCATCAACTATTATAATCCATTTGTACTACGTCTAGAAAACCGATGCTGTATAGATTCCACTAGAATAGGCGAGCTCCATTGACACATGACACATTTTTTCAACATTTCCTAAGGGCGCCCCTCATACGGAAAATGTCATCTTTATAAGTAATTCGCTCCGAAAGAAGGAGTACCTCAGCTTGTGGCTGCTGGTCGTTTGTGAGGTCCGCAATGAAGCTAAAGAAGCCGCGCTCCTCATAGGTATTTCCGAAGCCCGAGCCTCTCCTTTCCATCATCTTACTTTTCAA

Full Affymetrix probeset data:

Annotations for 1625849_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime