FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625850_at:

>probe:Drosophila_2:1625850_at:87:635; Interrogation_Position=1754; Antisense; TCGCAACCCAGTGAGCAGAAGAGTC
>probe:Drosophila_2:1625850_at:429:109; Interrogation_Position=1770; Antisense; AGAAGAGTCATCCTCCGTGCAATCG
>probe:Drosophila_2:1625850_at:540:509; Interrogation_Position=1786; Antisense; GTGCAATCGGTTCTATGTAGCAGAT
>probe:Drosophila_2:1625850_at:677:485; Interrogation_Position=1802; Antisense; GTAGCAGATCCCAATTGCGTTAAAC
>probe:Drosophila_2:1625850_at:726:215; Interrogation_Position=1876; Antisense; AAGTATTGCTAGCACAAGCCTCCTA
>probe:Drosophila_2:1625850_at:405:201; Interrogation_Position=1891; Antisense; AAGCCTCCTACAAATCGATTCCAAA
>probe:Drosophila_2:1625850_at:479:25; Interrogation_Position=2006; Antisense; ATAGTCGTAGTAGCCCATTCAGTTC
>probe:Drosophila_2:1625850_at:491:321; Interrogation_Position=2018; Antisense; GCCCATTCAGTTCGTAGTGCTTATG
>probe:Drosophila_2:1625850_at:706:633; Interrogation_Position=2076; Antisense; TCAAACAAACCTCAAACCCGCTTTG
>probe:Drosophila_2:1625850_at:170:497; Interrogation_Position=2165; Antisense; GTGTAATGTTAAACCCCGACGAGTG
>probe:Drosophila_2:1625850_at:394:303; Interrogation_Position=2180; Antisense; CCGACGAGTGTCATGATTACTTACT
>probe:Drosophila_2:1625850_at:458:3; Interrogation_Position=2224; Antisense; ATTGTCGCTATAGCAATTGTGACTA
>probe:Drosophila_2:1625850_at:635:511; Interrogation_Position=2242; Antisense; GTGACTATGCACAACGATCTCATTG
>probe:Drosophila_2:1625850_at:330:451; Interrogation_Position=2257; Antisense; GATCTCATTGTCGTCTATATGTATG

Paste this into a BLAST search page for me
TCGCAACCCAGTGAGCAGAAGAGTCAGAAGAGTCATCCTCCGTGCAATCGGTGCAATCGGTTCTATGTAGCAGATGTAGCAGATCCCAATTGCGTTAAACAAGTATTGCTAGCACAAGCCTCCTAAAGCCTCCTACAAATCGATTCCAAAATAGTCGTAGTAGCCCATTCAGTTCGCCCATTCAGTTCGTAGTGCTTATGTCAAACAAACCTCAAACCCGCTTTGGTGTAATGTTAAACCCCGACGAGTGCCGACGAGTGTCATGATTACTTACTATTGTCGCTATAGCAATTGTGACTAGTGACTATGCACAACGATCTCATTGGATCTCATTGTCGTCTATATGTATG

Full Affymetrix probeset data:

Annotations for 1625850_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720