FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625853_at:

>probe:Drosophila_2:1625853_at:519:351; Interrogation_Position=181; Antisense; GCAGAGCAATGTCGCAAGGCACTTA
>probe:Drosophila_2:1625853_at:244:397; Interrogation_Position=22; Antisense; GACAATATGCTCGACTTTACAGACT
>probe:Drosophila_2:1625853_at:682:481; Interrogation_Position=261; Antisense; GTATCTGCTGGATTTGCATTCGGAG
>probe:Drosophila_2:1625853_at:257:349; Interrogation_Position=301; Antisense; GCAGGGACTCGTTTTGTGACCAATC
>probe:Drosophila_2:1625853_at:18:665; Interrogation_Position=336; Antisense; TAAATTGCATTTCCTAGACGAGACG
>probe:Drosophila_2:1625853_at:693:217; Interrogation_Position=371; Antisense; AAGTCGAATTGTCTGACGCCGTAGA
>probe:Drosophila_2:1625853_at:171:299; Interrogation_Position=419; Antisense; CGCTTTATTGCGAAATCCTGGCTTT
>probe:Drosophila_2:1625853_at:386:235; Interrogation_Position=432; Antisense; AATCCTGGCTTTGGACAGCGACATG
>probe:Drosophila_2:1625853_at:573:153; Interrogation_Position=452; Antisense; ACATGGGCAGTGTCGCCTATTTGGA
>probe:Drosophila_2:1625853_at:183:101; Interrogation_Position=476; Antisense; AGAGGGTCGCCCAGATCAACAAAGA
>probe:Drosophila_2:1625853_at:621:395; Interrogation_Position=540; Antisense; GACAAGCAACATCCATTGTTCCGGC
>probe:Drosophila_2:1625853_at:388:273; Interrogation_Position=553; Antisense; CATTGTTCCGGCCAAGGCGTCAAAA
>probe:Drosophila_2:1625853_at:36:553; Interrogation_Position=60; Antisense; GGACTTACCGAACATAACTCTGCAC
>probe:Drosophila_2:1625853_at:723:255; Interrogation_Position=82; Antisense; CACAATATCCGTCCCATTTACAGTA

Paste this into a BLAST search page for me
GCAGAGCAATGTCGCAAGGCACTTAGACAATATGCTCGACTTTACAGACTGTATCTGCTGGATTTGCATTCGGAGGCAGGGACTCGTTTTGTGACCAATCTAAATTGCATTTCCTAGACGAGACGAAGTCGAATTGTCTGACGCCGTAGACGCTTTATTGCGAAATCCTGGCTTTAATCCTGGCTTTGGACAGCGACATGACATGGGCAGTGTCGCCTATTTGGAAGAGGGTCGCCCAGATCAACAAAGAGACAAGCAACATCCATTGTTCCGGCCATTGTTCCGGCCAAGGCGTCAAAAGGACTTACCGAACATAACTCTGCACCACAATATCCGTCCCATTTACAGTA

Full Affymetrix probeset data:

Annotations for 1625853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720