Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625854_at:

>probe:Drosophila_2:1625854_at:610:257; Interrogation_Position=1575; Antisense; CACAGTATTGCAATCCAGAGGGCTA
>probe:Drosophila_2:1625854_at:602:265; Interrogation_Position=1590; Antisense; CAGAGGGCTACATCCACGAGACAAA
>probe:Drosophila_2:1625854_at:462:515; Interrogation_Position=1619; Antisense; GTGTACCGGGTGATATCCCATGCCA
>probe:Drosophila_2:1625854_at:328:121; Interrogation_Position=1652; Antisense; AGCGGCGAGCCGTCCACAAAGTTTA
>probe:Drosophila_2:1625854_at:215:627; Interrogation_Position=1664; Antisense; TCCACAAAGTTTAGCTGGTTCCCCG
>probe:Drosophila_2:1625854_at:495:633; Interrogation_Position=1683; Antisense; TCCCCGGCTATCAGTGGCACATTAT
>probe:Drosophila_2:1625854_at:538:15; Interrogation_Position=1703; Antisense; ATTATTCTGTGCAAGTTCTGCGCCC
>probe:Drosophila_2:1625854_at:311:289; Interrogation_Position=1795; Antisense; CGGCTCCAGCGTGCGGATTGGAAAA
>probe:Drosophila_2:1625854_at:148:683; Interrogation_Position=1867; Antisense; TATGATGCGGATGATCTCAAGCGAT
>probe:Drosophila_2:1625854_at:27:583; Interrogation_Position=1904; Antisense; TGGCGCGTTGTGAAGCGATTTTTCA
>probe:Drosophila_2:1625854_at:496:697; Interrogation_Position=1924; Antisense; TTTCAGATGTCAACTCTGCTGCTGG
>probe:Drosophila_2:1625854_at:511:283; Interrogation_Position=1939; Antisense; CTGCTGCTGGCGTCGTCAGGAGAAT
>probe:Drosophila_2:1625854_at:337:591; Interrogation_Position=1980; Antisense; TGGGACCTGTTTAATTCGTTTCACA
>probe:Drosophila_2:1625854_at:83:507; Interrogation_Position=2140; Antisense; GTGCCGCAAATGAGGTGGACAGCTT

Paste this into a BLAST search page for me
CACAGTATTGCAATCCAGAGGGCTACAGAGGGCTACATCCACGAGACAAAGTGTACCGGGTGATATCCCATGCCAAGCGGCGAGCCGTCCACAAAGTTTATCCACAAAGTTTAGCTGGTTCCCCGTCCCCGGCTATCAGTGGCACATTATATTATTCTGTGCAAGTTCTGCGCCCCGGCTCCAGCGTGCGGATTGGAAAATATGATGCGGATGATCTCAAGCGATTGGCGCGTTGTGAAGCGATTTTTCATTTCAGATGTCAACTCTGCTGCTGGCTGCTGCTGGCGTCGTCAGGAGAATTGGGACCTGTTTAATTCGTTTCACAGTGCCGCAAATGAGGTGGACAGCTT

Full Affymetrix probeset data:

Annotations for 1625854_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime